ID: 963514486

View in Genome Browser
Species Human (GRCh38)
Location 3:146291752-146291774
Sequence CAAAATAAAGAGATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963514486_963514489 7 Left 963514486 3:146291752-146291774 CCTTCCTCCATCTCTTTATTTTG No data
Right 963514489 3:146291782-146291804 GTGTGTCCCTGCACATGAGATGG No data
963514486_963514490 8 Left 963514486 3:146291752-146291774 CCTTCCTCCATCTCTTTATTTTG No data
Right 963514490 3:146291783-146291805 TGTGTCCCTGCACATGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963514486 Original CRISPR CAAAATAAAGAGATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr