ID: 963518430

View in Genome Browser
Species Human (GRCh38)
Location 3:146336321-146336343
Sequence GAGTCCATATAGTAAGTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963518430_963518436 23 Left 963518430 3:146336321-146336343 CCTATGACTTACTATATGGACTC No data
Right 963518436 3:146336367-146336389 TCTTCCTACTATGGAAACCAAGG No data
963518430_963518431 -8 Left 963518430 3:146336321-146336343 CCTATGACTTACTATATGGACTC No data
Right 963518431 3:146336336-146336358 ATGGACTCCCATATTTGTGCAGG No data
963518430_963518435 14 Left 963518430 3:146336321-146336343 CCTATGACTTACTATATGGACTC No data
Right 963518435 3:146336358-146336380 GGCTACAGATCTTCCTACTATGG No data
963518430_963518432 -7 Left 963518430 3:146336321-146336343 CCTATGACTTACTATATGGACTC No data
Right 963518432 3:146336337-146336359 TGGACTCCCATATTTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963518430 Original CRISPR GAGTCCATATAGTAAGTCAT AGG (reversed) Intergenic