ID: 963518431

View in Genome Browser
Species Human (GRCh38)
Location 3:146336336-146336358
Sequence ATGGACTCCCATATTTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963518424_963518431 18 Left 963518424 3:146336295-146336317 CCCAAGAGAATACTTGGGATTGT No data
Right 963518431 3:146336336-146336358 ATGGACTCCCATATTTGTGCAGG No data
963518429_963518431 -7 Left 963518429 3:146336320-146336342 CCCTATGACTTACTATATGGACT No data
Right 963518431 3:146336336-146336358 ATGGACTCCCATATTTGTGCAGG No data
963518428_963518431 -6 Left 963518428 3:146336319-146336341 CCCCTATGACTTACTATATGGAC No data
Right 963518431 3:146336336-146336358 ATGGACTCCCATATTTGTGCAGG No data
963518427_963518431 -5 Left 963518427 3:146336318-146336340 CCCCCTATGACTTACTATATGGA No data
Right 963518431 3:146336336-146336358 ATGGACTCCCATATTTGTGCAGG No data
963518425_963518431 17 Left 963518425 3:146336296-146336318 CCAAGAGAATACTTGGGATTGTC No data
Right 963518431 3:146336336-146336358 ATGGACTCCCATATTTGTGCAGG No data
963518430_963518431 -8 Left 963518430 3:146336321-146336343 CCTATGACTTACTATATGGACTC No data
Right 963518431 3:146336336-146336358 ATGGACTCCCATATTTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963518431 Original CRISPR ATGGACTCCCATATTTGTGC AGG Intergenic