ID: 963518433

View in Genome Browser
Species Human (GRCh38)
Location 3:146336343-146336365
Sequence CTGTAGCCCTGCACAAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963518433_963518435 -8 Left 963518433 3:146336343-146336365 CCCATATTTGTGCAGGGCTACAG No data
Right 963518435 3:146336358-146336380 GGCTACAGATCTTCCTACTATGG No data
963518433_963518436 1 Left 963518433 3:146336343-146336365 CCCATATTTGTGCAGGGCTACAG No data
Right 963518436 3:146336367-146336389 TCTTCCTACTATGGAAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963518433 Original CRISPR CTGTAGCCCTGCACAAATAT GGG (reversed) Intergenic