ID: 963518434

View in Genome Browser
Species Human (GRCh38)
Location 3:146336344-146336366
Sequence TCTGTAGCCCTGCACAAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963518434_963518435 -9 Left 963518434 3:146336344-146336366 CCATATTTGTGCAGGGCTACAGA No data
Right 963518435 3:146336358-146336380 GGCTACAGATCTTCCTACTATGG No data
963518434_963518436 0 Left 963518434 3:146336344-146336366 CCATATTTGTGCAGGGCTACAGA No data
Right 963518436 3:146336367-146336389 TCTTCCTACTATGGAAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963518434 Original CRISPR TCTGTAGCCCTGCACAAATA TGG (reversed) Intergenic