ID: 963518434 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:146336344-146336366 |
| Sequence | TCTGTAGCCCTGCACAAATA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 963518434_963518435 | -9 | Left | 963518434 | 3:146336344-146336366 | CCATATTTGTGCAGGGCTACAGA | No data | ||
| Right | 963518435 | 3:146336358-146336380 | GGCTACAGATCTTCCTACTATGG | No data | ||||
| 963518434_963518436 | 0 | Left | 963518434 | 3:146336344-146336366 | CCATATTTGTGCAGGGCTACAGA | No data | ||
| Right | 963518436 | 3:146336367-146336389 | TCTTCCTACTATGGAAACCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 963518434 | Original CRISPR | TCTGTAGCCCTGCACAAATA TGG (reversed) | Intergenic | ||