ID: 963518435

View in Genome Browser
Species Human (GRCh38)
Location 3:146336358-146336380
Sequence GGCTACAGATCTTCCTACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963518433_963518435 -8 Left 963518433 3:146336343-146336365 CCCATATTTGTGCAGGGCTACAG No data
Right 963518435 3:146336358-146336380 GGCTACAGATCTTCCTACTATGG No data
963518427_963518435 17 Left 963518427 3:146336318-146336340 CCCCCTATGACTTACTATATGGA No data
Right 963518435 3:146336358-146336380 GGCTACAGATCTTCCTACTATGG No data
963518434_963518435 -9 Left 963518434 3:146336344-146336366 CCATATTTGTGCAGGGCTACAGA No data
Right 963518435 3:146336358-146336380 GGCTACAGATCTTCCTACTATGG No data
963518430_963518435 14 Left 963518430 3:146336321-146336343 CCTATGACTTACTATATGGACTC No data
Right 963518435 3:146336358-146336380 GGCTACAGATCTTCCTACTATGG No data
963518428_963518435 16 Left 963518428 3:146336319-146336341 CCCCTATGACTTACTATATGGAC No data
Right 963518435 3:146336358-146336380 GGCTACAGATCTTCCTACTATGG No data
963518429_963518435 15 Left 963518429 3:146336320-146336342 CCCTATGACTTACTATATGGACT No data
Right 963518435 3:146336358-146336380 GGCTACAGATCTTCCTACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963518435 Original CRISPR GGCTACAGATCTTCCTACTA TGG Intergenic
No off target data available for this crispr