ID: 963521427

View in Genome Browser
Species Human (GRCh38)
Location 3:146363072-146363094
Sequence GCAAGTCCTGCTTTTCTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963521419_963521427 -4 Left 963521419 3:146363053-146363075 CCCTTCTCCTTCACCCTTAGCAA No data
Right 963521427 3:146363072-146363094 GCAAGTCCTGCTTTTCTAGGGGG No data
963521417_963521427 3 Left 963521417 3:146363046-146363068 CCTCAACCCCTTCTCCTTCACCC 0: 458
1: 207
2: 56
3: 137
4: 1396
Right 963521427 3:146363072-146363094 GCAAGTCCTGCTTTTCTAGGGGG No data
963521415_963521427 5 Left 963521415 3:146363044-146363066 CCCCTCAACCCCTTCTCCTTCAC 0: 407
1: 144
2: 39
3: 71
4: 574
Right 963521427 3:146363072-146363094 GCAAGTCCTGCTTTTCTAGGGGG No data
963521418_963521427 -3 Left 963521418 3:146363052-146363074 CCCCTTCTCCTTCACCCTTAGCA 0: 83
1: 247
2: 292
3: 140
4: 509
Right 963521427 3:146363072-146363094 GCAAGTCCTGCTTTTCTAGGGGG No data
963521416_963521427 4 Left 963521416 3:146363045-146363067 CCCTCAACCCCTTCTCCTTCACC 0: 375
1: 236
2: 100
3: 101
4: 1002
Right 963521427 3:146363072-146363094 GCAAGTCCTGCTTTTCTAGGGGG No data
963521420_963521427 -5 Left 963521420 3:146363054-146363076 CCTTCTCCTTCACCCTTAGCAAG No data
Right 963521427 3:146363072-146363094 GCAAGTCCTGCTTTTCTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963521427 Original CRISPR GCAAGTCCTGCTTTTCTAGG GGG Intergenic
No off target data available for this crispr