ID: 963523445

View in Genome Browser
Species Human (GRCh38)
Location 3:146385595-146385617
Sequence GCAAATATAAAGTTTAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963523445_963523447 26 Left 963523445 3:146385595-146385617 CCATTTTTAAACTTTATATTTGC No data
Right 963523447 3:146385644-146385666 AACTCTTAACAAAATAATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963523445 Original CRISPR GCAAATATAAAGTTTAAAAA TGG (reversed) Intergenic
No off target data available for this crispr