ID: 963525423

View in Genome Browser
Species Human (GRCh38)
Location 3:146409471-146409493
Sequence TGGTCAGAAGGCCCCCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 246}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963525423_963525432 22 Left 963525423 3:146409471-146409493 CCATGGAGGGGGCCTTCTGACCA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 963525432 3:146409516-146409538 GGGAAACTGATCAGGGTGGCCGG 0: 5
1: 7
2: 7
3: 19
4: 218
963525423_963525430 15 Left 963525423 3:146409471-146409493 CCATGGAGGGGGCCTTCTGACCA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 963525430 3:146409509-146409531 TAATGTAGGGAAACTGATCAGGG 0: 3
1: 13
2: 16
3: 22
4: 151
963525423_963525429 14 Left 963525423 3:146409471-146409493 CCATGGAGGGGGCCTTCTGACCA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 963525429 3:146409508-146409530 TTAATGTAGGGAAACTGATCAGG 0: 1
1: 21
2: 15
3: 22
4: 163
963525423_963525433 23 Left 963525423 3:146409471-146409493 CCATGGAGGGGGCCTTCTGACCA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 963525433 3:146409517-146409539 GGAAACTGATCAGGGTGGCCGGG 0: 4
1: 17
2: 15
3: 49
4: 284
963525423_963525431 18 Left 963525423 3:146409471-146409493 CCATGGAGGGGGCCTTCTGACCA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 963525431 3:146409512-146409534 TGTAGGGAAACTGATCAGGGTGG 0: 11
1: 6
2: 3
3: 16
4: 177
963525423_963525427 2 Left 963525423 3:146409471-146409493 CCATGGAGGGGGCCTTCTGACCA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 963525427 3:146409496-146409518 CTCAACCATTGATTAATGTAGGG 0: 1
1: 0
2: 10
3: 13
4: 116
963525423_963525426 1 Left 963525423 3:146409471-146409493 CCATGGAGGGGGCCTTCTGACCA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 963525426 3:146409495-146409517 ACTCAACCATTGATTAATGTAGG 0: 1
1: 0
2: 8
3: 18
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963525423 Original CRISPR TGGTCAGAAGGCCCCCTCCA TGG (reversed) Intronic