ID: 963525423

View in Genome Browser
Species Human (GRCh38)
Location 3:146409471-146409493
Sequence TGGTCAGAAGGCCCCCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 246}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963525423_963525432 22 Left 963525423 3:146409471-146409493 CCATGGAGGGGGCCTTCTGACCA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 963525432 3:146409516-146409538 GGGAAACTGATCAGGGTGGCCGG 0: 5
1: 7
2: 7
3: 19
4: 218
963525423_963525433 23 Left 963525423 3:146409471-146409493 CCATGGAGGGGGCCTTCTGACCA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 963525433 3:146409517-146409539 GGAAACTGATCAGGGTGGCCGGG 0: 4
1: 17
2: 15
3: 49
4: 284
963525423_963525426 1 Left 963525423 3:146409471-146409493 CCATGGAGGGGGCCTTCTGACCA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 963525426 3:146409495-146409517 ACTCAACCATTGATTAATGTAGG 0: 1
1: 0
2: 8
3: 18
4: 121
963525423_963525431 18 Left 963525423 3:146409471-146409493 CCATGGAGGGGGCCTTCTGACCA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 963525431 3:146409512-146409534 TGTAGGGAAACTGATCAGGGTGG 0: 11
1: 6
2: 3
3: 16
4: 177
963525423_963525427 2 Left 963525423 3:146409471-146409493 CCATGGAGGGGGCCTTCTGACCA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 963525427 3:146409496-146409518 CTCAACCATTGATTAATGTAGGG 0: 1
1: 0
2: 10
3: 13
4: 116
963525423_963525430 15 Left 963525423 3:146409471-146409493 CCATGGAGGGGGCCTTCTGACCA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 963525430 3:146409509-146409531 TAATGTAGGGAAACTGATCAGGG 0: 3
1: 13
2: 16
3: 22
4: 151
963525423_963525429 14 Left 963525423 3:146409471-146409493 CCATGGAGGGGGCCTTCTGACCA 0: 1
1: 0
2: 2
3: 27
4: 246
Right 963525429 3:146409508-146409530 TTAATGTAGGGAAACTGATCAGG 0: 1
1: 21
2: 15
3: 22
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963525423 Original CRISPR TGGTCAGAAGGCCCCCTCCA TGG (reversed) Intronic
900464566 1:2819002-2819024 TGATCTCAAGGCACCCTCCAAGG + Intergenic
900491488 1:2951474-2951496 AGCTCAGACGGGCCCCTCCATGG - Intergenic
900719537 1:4166430-4166452 TGGGCAGATAGCCCCTTCCAGGG - Intergenic
901157757 1:7151757-7151779 TGGGAAGGAGGCTCCCTCCAGGG - Intronic
901493958 1:9610800-9610822 TGGTCAGAAGGCCGTACCCAGGG - Exonic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
903643313 1:24875141-24875163 TTGGCAGGAGGCCCTCTCCAGGG - Intergenic
904673263 1:32181462-32181484 TGGAGAGAAGGAACCCTCCAAGG + Exonic
904778076 1:32924146-32924168 TGGTCCGGAGCCCTCCTCCATGG - Intergenic
905813246 1:40928580-40928602 TGGTCAGGATGGCCCCTCCAAGG - Intergenic
907023645 1:51094303-51094325 TGGTCTAAATGCTCCCTCCACGG - Intergenic
908397686 1:63741143-63741165 TTGTCTAAAGGCTCCCTCCATGG + Intergenic
909231333 1:73093959-73093981 TGGTCATGATGCTCCCTCCATGG + Intergenic
909320582 1:74280616-74280638 TGGTCTAAATGCTCCCTCCATGG - Intronic
909710443 1:78643688-78643710 CAGTCTGAAGACCCCCTCCAAGG - Exonic
909797703 1:79763527-79763549 TGGTTAAAAGGCCCCCTCAAAGG - Intergenic
910458708 1:87425506-87425528 TGGTCAAAGGGCCCCATACAGGG - Intergenic
911239510 1:95449602-95449624 TGGTCTAAATGCTCCCTCCATGG + Intergenic
913494464 1:119415517-119415539 TGGTCTGAAGGCCTTGTCCAAGG - Exonic
913511198 1:119564166-119564188 TGGTCTGAAGGCCTTGTCCAAGG - Intergenic
914947620 1:152080502-152080524 TGGTCTGGAGCCCCCCTTCAAGG - Intergenic
916341927 1:163745850-163745872 TGGTCCAAATGCTCCCTCCATGG + Intergenic
917711438 1:177689106-177689128 TGGTCTGAATGCAGCCTCCAGGG - Intergenic
918854249 1:189729996-189730018 TGATCTAAAGGCCCACTCCATGG + Intergenic
921002159 1:211055347-211055369 TGGTCTGAATTCTCCCTCCATGG - Intronic
1064250898 10:13705709-13705731 CGGCCAGAAGCCCCACTCCATGG - Intronic
1065327033 10:24558348-24558370 TGGTCAGCAGACCGCCTCCCGGG - Intergenic
1067085666 10:43236982-43237004 TGGTCCTAAGACCCCCTACAAGG - Intronic
1068136320 10:52953633-52953655 TGGTCTGGAGCCCTCCTCCACGG - Intergenic
1071215364 10:83394300-83394322 TGGTTTGAAGGCTCCCTCCATGG + Intergenic
1071962096 10:90817013-90817035 TGGCCACAAGGGCCCCACCAAGG + Intronic
1072344412 10:94489217-94489239 TGTTCAAAATGCTCCCTCCATGG + Intronic
1072625040 10:97105877-97105899 TGGTCCGGAGGCCTCCGCCAAGG + Intronic
1075263483 10:120981847-120981869 GGGGCAGGAGGCCCCCTGCAAGG - Intergenic
1075496271 10:122922258-122922280 TGGTCTAAATGCTCCCTCCATGG - Intergenic
1076719568 10:132387236-132387258 TGGGCGGAAGCCCCCCTCCCTGG + Intergenic
1080966630 11:37220475-37220497 TGGTCTAAATGCTCCCTCCATGG + Intergenic
1081319062 11:41668429-41668451 TGGTCTAAATGCCTCCTCCATGG - Intergenic
1081862245 11:46339817-46339839 TTTTCAGAAAGGCCCCTCCAAGG + Intronic
1083528924 11:63398535-63398557 TGGTCTAAATGCTCCCTCCATGG + Intronic
1084823188 11:71708642-71708664 TAGTCAGGATCCCCCCTCCATGG + Intergenic
1085043541 11:73340731-73340753 TGGTCTGAAGGCCCCATCCCTGG - Intronic
1085118679 11:73952650-73952672 TGACCAGAAGGACCCATCCAGGG + Intronic
1085800447 11:79584663-79584685 TGGTCAGGTGGCCCCCATCAGGG + Intergenic
1087012242 11:93525091-93525113 TGGTCAGAATACCCTCTCCCAGG + Intronic
1087032125 11:93716207-93716229 TGGTCTAAATGCTCCCTCCAAGG + Intronic
1087313487 11:96577863-96577885 TGGTCCAAATGCTCCCTCCATGG + Intergenic
1088274039 11:108065507-108065529 TGGTCTAAATGCTCCCTCCATGG + Intronic
1092419911 12:8322246-8322268 TAGTCAGGATCCCCCCTCCATGG - Intergenic
1092477127 12:8828859-8828881 TGGTCTAAATGCTCCCTCCATGG + Intronic
1092528761 12:9327049-9327071 TGGTCCGGAGCCCTCCTCCACGG - Intergenic
1093420126 12:18965286-18965308 TGGTCTGAATGCTCCCTCCATGG + Intergenic
1097345602 12:58488695-58488717 TGCTCAGAAGGCCCTCTGCTTGG - Intergenic
1097426131 12:59446615-59446637 TGGTCTAAATGCTCCCTCCATGG + Intergenic
1097776739 12:63655798-63655820 TGCTCAGAAAGCATCCTCCATGG - Intronic
1101226559 12:102693824-102693846 TGGTTTAAATGCCCCCTCCATGG - Intergenic
1102641859 12:114373924-114373946 TGGTGAGAAGGAGTCCTCCAAGG + Intronic
1104672176 12:130688492-130688514 TGGTCACATGGCCGCCCCCACGG - Intronic
1106074668 13:26447998-26448020 TGGTCTAAATGCTCCCTCCATGG - Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1110018900 13:70443452-70443474 TGGTCAGAAGGCCTCTGCTAAGG + Intergenic
1110404567 13:75135425-75135447 TGGTCAGAAGGGCCCCACTGTGG - Intergenic
1111446704 13:88355583-88355605 TGGTCCATATGCCCCCTCCAGGG - Intergenic
1111449015 13:88390375-88390397 TGGTCTGAATACCCCTTCCATGG - Intergenic
1115456688 14:33612186-33612208 TGGTCAGAAGGCCCCTGCCGGGG + Intronic
1120697335 14:87659140-87659162 TGGTCTAAATGCTCCCTCCATGG - Intergenic
1120734378 14:88036884-88036906 TGACCAAAAGTCCCCCTCCAGGG + Intergenic
1120770967 14:88380080-88380102 CGGTCCAAATGCCCCCTCCATGG + Intergenic
1121795089 14:96728064-96728086 ATGTCAGAAGGGACCCTCCAGGG + Intergenic
1122638593 14:103143090-103143112 TGGTCAGAAGCAGCCCTGCATGG + Intergenic
1123084993 14:105713214-105713236 TGGCCCCAAGGCCCCCTCAACGG - Intergenic
1123415367 15:20091164-20091186 TGATCAGAAGCCCCCCTAAAAGG + Intergenic
1126855864 15:52838796-52838818 TGGTCAGGGGGCCTCTTCCATGG + Intergenic
1129030739 15:72615922-72615944 TGGTCTAAATGCTCCCTCCATGG + Intergenic
1129835649 15:78703723-78703745 TGGTCTAAATGCTCCCTCCATGG + Intronic
1130511685 15:84594913-84594935 TGGTCTAAATGCTCCCTCCATGG - Intergenic
1132959561 16:2614303-2614325 TGGACAGAGGGAGCCCTCCAAGG - Intergenic
1132972622 16:2696278-2696300 TGGACAGAGGGAGCCCTCCAAGG - Intronic
1133029225 16:3001714-3001736 TGGTCAGCAAGCCCCTTGCATGG - Intergenic
1133076799 16:3286088-3286110 TAGTAAGAGGGCCCTCTCCAGGG + Exonic
1135324154 16:21515348-21515370 CTGTCAGAAGTCCCCCTACAAGG + Intergenic
1136335635 16:29608620-29608642 CTGTCAGAAGTCCCCCTACAAGG + Intergenic
1136934028 16:34442398-34442420 TGGTCCTAAGACCCCCTCCCAGG - Intergenic
1136970544 16:34969416-34969438 TGGTCCTAAGACCCCCTCCCAGG + Intergenic
1137340235 16:47594713-47594735 TGGTCAGAAGGCCCAGTCTTAGG + Intronic
1137495221 16:48964283-48964305 AGGTAGGAAGGCCTCCTCCAAGG + Intergenic
1139374966 16:66491192-66491214 TGGGCAGGAGGGCCCCTCCATGG + Intronic
1139517410 16:67459929-67459951 TGGCCAGCAAGACCCCTCCATGG - Intronic
1139531631 16:67545415-67545437 TGCCCAGAAGGCCCCAGCCAGGG + Exonic
1142005321 16:87687025-87687047 CGGTCCCAACGCCCCCTCCAGGG - Intronic
1142643695 17:1299270-1299292 TGGTCCCAAAGCCTCCTCCAGGG - Exonic
1142671735 17:1490835-1490857 CGGTGCGAAGGCCCCCTCCTGGG - Intronic
1142814240 17:2412760-2412782 TGCTGAGCAGGCCCCCTCCTGGG - Intronic
1143514304 17:7411691-7411713 CTCTCAGAAGGCCCCCTTCAGGG - Intronic
1143894797 17:10127689-10127711 GGGGCAGAAGGCCCCCTCCAAGG + Intronic
1147609374 17:41792721-41792743 TACTCAGAAGGCCCCCTTCAGGG + Intergenic
1149234796 17:54577597-54577619 TGATTAAAATGCCCCCTCCATGG - Intergenic
1149249334 17:54749941-54749963 TGGTCTAAATGCTCCCTCCATGG + Intergenic
1151256359 17:72879843-72879865 TGGTCTGAAGACCCCCGCCAAGG + Intronic
1152068027 17:78122058-78122080 TGACCAGAAGCCCCCCTACACGG + Intronic
1152894183 17:82901276-82901298 AGGTCAGAGGGTCCCCTCCTAGG + Intronic
1152915973 17:83036196-83036218 TGACAAGAAGGCACCCTCCAGGG + Intronic
1153004718 18:487698-487720 TAGCCAGAAAGTCCCCTCCATGG + Intronic
1153183411 18:2460643-2460665 TGGTCTAAATGCTCCCTCCATGG + Intergenic
1153792646 18:8594043-8594065 TGGTCAGTAGGCACCTTGCACGG + Intergenic
1155914158 18:31539656-31539678 TGGACAGAGGGCCGCCTCCAAGG + Intronic
1157621243 18:49018534-49018556 TGGTCAGCAGGCCCCTTCTCCGG + Intergenic
1159285029 18:66337462-66337484 TGGTCCAAATGCTCCCTCCATGG + Intergenic
1160754774 19:751501-751523 AGGCCAGAGGGGCCCCTCCATGG + Intronic
1160764886 19:803155-803177 AGGGCAGAGGACCCCCTCCATGG - Intronic
1163928139 19:20364591-20364613 TGGTCAGGAGCCCCCCTCCATGG + Intergenic
1164219929 19:23184136-23184158 TGGTCAGGAGCCCTCTTCCATGG - Intergenic
1164792071 19:30995783-30995805 TAATCAGAAGACCCCCCCCATGG - Intergenic
1167050090 19:47072599-47072621 TGGGCAGGAGGCCCACACCAGGG + Exonic
925330368 2:3053975-3053997 TGTTCAGAAGGCCCCATACTTGG + Intergenic
926620644 2:15043827-15043849 GAGTCAGAAGGCACCCTCCAAGG - Intergenic
926736491 2:16077365-16077387 TAGTCAGATGACCCCATCCAAGG - Intergenic
927264677 2:21132032-21132054 TGGTCAGAAGATCCCCTTCTAGG - Intronic
928361332 2:30664501-30664523 TGGTCAGAAGGGCCCTGCTAAGG + Intergenic
930041626 2:47129495-47129517 TGGTCTAAATGCTCCCTCCATGG + Intronic
930469169 2:51791934-51791956 TGGTCTAAATGCCCCCTCCATGG - Intergenic
934538107 2:95153172-95153194 TGCTCAGAAGGACCTCTACAGGG - Exonic
934569507 2:95359908-95359930 TGGGCCAAGGGCCCCCTCCAAGG - Intronic
934941625 2:98507118-98507140 TGGCCAGAATGGCCCCTTCAGGG - Intronic
936072658 2:109381654-109381676 TTGTCAGAAGGCCCCCAGGATGG + Intronic
940855329 2:158724754-158724776 TGAGCAGCAGTCCCCCTCCAGGG - Intergenic
942463988 2:176189058-176189080 AGGTTCGTAGGCCCCCTCCAGGG - Exonic
942975861 2:182016134-182016156 TGGTCTAAATGCCCCCTCCATGG + Intronic
943782071 2:191836114-191836136 TGCTGAGAAGGCGACCTCCAGGG - Exonic
944661597 2:201926142-201926164 AGGGCAGAAGCCACCCTCCAAGG - Intergenic
944990633 2:205230843-205230865 TGGTCTGAGTGCTCCCTCCATGG + Intronic
946295590 2:218781667-218781689 TGTTCAGCGGCCCCCCTCCAGGG + Intergenic
946332826 2:219019767-219019789 TGGCCTGCATGCCCCCTCCAGGG - Intronic
947760302 2:232599251-232599273 TGGTCAGACTGTCCCCTCCCAGG + Intergenic
948298870 2:236886958-236886980 TGGTCTTGAGGCCCCATCCAGGG + Intergenic
948336002 2:237207500-237207522 GGTTCAGGAGCCCCCCTCCATGG - Intergenic
948774564 2:240277173-240277195 TGGTCTGAATGCTCCCTCCATGG - Intergenic
1169392113 20:5198732-5198754 TGGGCAGAGGGCCCACGCCAGGG - Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1171942797 20:31348014-31348036 TGGTCCAAATGCTCCCTCCATGG - Intergenic
1172605190 20:36209188-36209210 TGGACAGGAGGCTCCATCCAAGG - Intronic
1173431029 20:42987251-42987273 TGGCCAGTAGGCACCCTCTAGGG - Intronic
1173452233 20:43175218-43175240 GGCTAAGAAGGTCCCCTCCACGG + Intronic
1174445461 20:50587918-50587940 TGTTGAGAAGGCCCCCTAAAGGG - Intronic
1174745575 20:53058504-53058526 TGCTCAGAAGGGCCCATACATGG - Intronic
1175328629 20:58147540-58147562 TGGTCACAAAGCCCTCTGCAAGG + Intergenic
1175728497 20:61335645-61335667 TTGTCAGAAAACTCCCTCCATGG + Intronic
1176915596 21:14621811-14621833 TGGACAGACTGCCCCCTCAAGGG + Intronic
1176942451 21:14940358-14940380 TACTCAGAAGGCAGCCTCCAGGG + Intergenic
1179489274 21:41729783-41729805 TGGTCAGAAGACCTGGTCCAAGG - Intergenic
1181475035 22:23162743-23162765 TGATCAGAAGGCTGCCTGCAAGG - Exonic
1183283485 22:36947433-36947455 TGGTCTGAAGGACCCCACAATGG + Intergenic
1185362089 22:50414396-50414418 TTGTAAGAAAGCCCCCTCAAGGG - Intronic
949877392 3:8635188-8635210 GGTGCAGACGGCCCCCTCCAGGG + Intronic
950750030 3:15121144-15121166 AGGCCAGCAGGCCCTCTCCAGGG + Intergenic
950801189 3:15552882-15552904 TGGTCTAAATGCTCCCTCCATGG + Intergenic
952115856 3:30180712-30180734 TGGTCTGAAGACCCCCACCAAGG - Intergenic
952737286 3:36703400-36703422 TGGTAAGATGCCTCCCTCCATGG + Intergenic
952966106 3:38622301-38622323 TGGACACAAGCCCCCTTCCAGGG + Intronic
954622140 3:52002379-52002401 CTGTCACAAGGCCCCCTCCATGG - Intergenic
957369396 3:79272703-79272725 TGGTCTAAATGCTCCCTCCATGG - Intronic
959259233 3:104053366-104053388 TGGTCCAAATGCTCCCTCCATGG - Intergenic
959295623 3:104531035-104531057 TGGTCTGCTGGCCCCTTCCAGGG + Intergenic
959841647 3:110983653-110983675 TGGTTTAAATGCCCCCTCCATGG - Intergenic
959913830 3:111794206-111794228 TGGTCTAAATGCTCCCTCCATGG + Intronic
961897600 3:130181439-130181461 TAGTCAGGATCCCCCCTCCATGG - Intergenic
963525423 3:146409471-146409493 TGGTCAGAAGGCCCCCTCCATGG - Intronic
964244343 3:154633450-154633472 TGGTCCAAATGCTCCCTCCACGG + Intergenic
964763594 3:160157328-160157350 TGGTCATCAGGGCCCTTCCAGGG - Intergenic
968218469 3:196915023-196915045 TAGTCTGAATGCTCCCTCCATGG - Intronic
969053584 4:4388200-4388222 TGGTCAGATGGCCCCTCCCCAGG + Intronic
969307358 4:6333481-6333503 GGCTAGGAAGGCCCCCTCCATGG + Intronic
970098066 4:12487358-12487380 TGGTCCAAATGCTCCCTCCATGG + Intergenic
970542405 4:17093164-17093186 TGGTCAGAAGTTCCCCTTCGTGG + Intergenic
973919928 4:55674234-55674256 TGGTCTAAATGCTCCCTCCATGG + Intergenic
974333066 4:60505056-60505078 TGGTCTGAATGCTCCCTCCATGG - Intergenic
975592892 4:76017798-76017820 TGGTCTAAATGCTCCCTCCATGG + Intronic
976747281 4:88416024-88416046 TGGTCTGAAGACCCTCACCAAGG - Intronic
978342431 4:107732980-107733002 TGGTCAGTAGGAGCCTTCCATGG + Intergenic
980146091 4:128986264-128986286 TGGTCTAAATGCTCCCTCCATGG - Intronic
983263426 4:165482310-165482332 TGGCCACAAGGTCTCCTCCATGG - Exonic
985974464 5:3405177-3405199 AGGTCAGAAGGCCACCTTAAGGG + Intergenic
986104065 5:4643220-4643242 TGGTGAGAAGGCCTTCTCCCTGG + Intergenic
987616014 5:20275969-20275991 TGGTCTAAATGCTCCCTCCATGG - Intronic
989502376 5:42182897-42182919 TGGTCTAAAAGCTCCCTCCATGG - Intergenic
990205496 5:53424692-53424714 TGGTCAGAAGAGCACTTCCATGG + Intergenic
991975474 5:72179984-72180006 TGGTAAGAAGGCTCCTGCCAGGG + Intronic
992622838 5:78610547-78610569 AGGCCAGAAGGCCCTCTTCATGG + Intronic
992657124 5:78922000-78922022 TGGTCTAAATGCTCCCTCCACGG - Intronic
992872595 5:81021971-81021993 CGGTCTGAAGACCCCCACCAAGG - Intronic
994081414 5:95711797-95711819 TGGTCAGGAATCCTCCTCCATGG - Intergenic
994217966 5:97159829-97159851 TGGTCTAAATGCTCCCTCCATGG + Intronic
994310177 5:98260023-98260045 TGGCCTAAATGCCCCCTCCATGG + Intergenic
994507038 5:100656664-100656686 TGGGCTGAAGGGCTCCTCCACGG - Intergenic
997523784 5:134539813-134539835 TCTGCAGAAGCCCCCCTCCAAGG - Intronic
997727462 5:136133264-136133286 GGGTCAGGGGGTCCCCTCCAGGG - Intronic
998215205 5:140232980-140233002 TGTTCAGAAGGACCTCCCCAGGG - Intronic
998232817 5:140372270-140372292 TGGTGAGAAGACCCTCTCCAGGG - Exonic
999762290 5:154711912-154711934 TGGTCAGGAGGCCCTCCCTAGGG - Intergenic
1001845269 5:174916540-174916562 TGGTCTCAATGCTCCCTCCATGG - Intergenic
1003460404 6:6323187-6323209 TGGTCAGCAGCCTCTCTCCAGGG - Intergenic
1005738957 6:28773474-28773496 TGGTCAGAAGCTCCCCACCATGG - Intergenic
1006426714 6:33967896-33967918 TGGACATAAGGCCCTCCCCAAGG - Intergenic
1007849758 6:44791800-44791822 TTGTCACAACGCCCCCTCCTTGG - Intergenic
1008878628 6:56356765-56356787 TGGGCAGCAGGGCTCCTCCATGG - Intronic
1009039454 6:58159010-58159032 TGGTCAAAAAGCTCCCTCCATGG + Intergenic
1009215344 6:60913850-60913872 TGCTCAAAAAGCTCCCTCCATGG + Intergenic
1013288594 6:108700613-108700635 CGGTCAGAAGGACACCTCCACGG - Intergenic
1013742641 6:113305728-113305750 TGGACAGATTGCCCCTTCCAAGG - Intergenic
1014430545 6:121365471-121365493 TGGTCTAAATGCACCCTCCATGG - Intergenic
1015460607 6:133487175-133487197 TGGTCTAAATGCCCCCTCCATGG - Intronic
1016541387 6:145170060-145170082 TGGTCTAAATGCTCCCTCCATGG - Intergenic
1016866455 6:148772406-148772428 AGGTCAGAAGGGCCCACCCAAGG - Intronic
1016941036 6:149482900-149482922 TGGCCAGAAGGCACCGCCCAGGG + Intronic
1017491592 6:154950346-154950368 TGGTCTAAATGCTCCCTCCATGG + Intronic
1017740882 6:157405587-157405609 TGGTCAGAAAAACCTCTCCAAGG + Intronic
1018962566 6:168458799-168458821 TGGTCTGAACGCCCACTCCTCGG + Intronic
1022359357 7:29643682-29643704 TGGTCCGGAGCCCTCCTCCATGG - Intergenic
1022361684 7:29665981-29666003 TGCTCAGAAAGCATCCTCCATGG + Intergenic
1022699707 7:32747743-32747765 TGCTCAGAAAGCATCCTCCATGG - Intergenic
1022935661 7:35173453-35173475 TGCTCAGAAAGCATCCTCCATGG - Intergenic
1023622907 7:42091057-42091079 TGGTCAGAAGGGCCCGAGCATGG + Intronic
1023863413 7:44228075-44228097 GGGGCAGAGGGCACCCTCCAGGG + Intronic
1024608799 7:51045640-51045662 TGCTCTGAGGGCCTCCTCCAAGG - Intronic
1026319904 7:69259246-69259268 TGGTCTGAAGGAACACTCCAGGG + Intergenic
1027405505 7:77855690-77855712 TGGTCTAAATGCTCCCTCCAGGG + Intronic
1029831614 7:103266187-103266209 TGCTCAGAAAGCATCCTCCATGG - Intergenic
1029969241 7:104773157-104773179 GGGTAAGAAGACCCCCACCAGGG - Intronic
1033887169 7:145963198-145963220 TGGTTTGAATGCTCCCTCCATGG - Intergenic
1034283516 7:149869487-149869509 TGGTCAGAAGCCCCTCCCCAGGG - Intergenic
1037134936 8:15449425-15449447 TGGTCAGAACCACCCCGCCATGG + Intronic
1039584259 8:38692694-38692716 TGGTCTGAAGACCCCCATCAAGG + Intergenic
1039998333 8:42554953-42554975 AGGGGAGAAGGCCGCCTCCAAGG + Intergenic
1042162528 8:65911914-65911936 TGGTCAAAATGCTTCCTCCATGG - Intergenic
1044235413 8:89824620-89824642 TGGTCTAAATGCTCCCTCCATGG + Intergenic
1047386646 8:124416156-124416178 TGGTAAGCAGCCCCCATCCAGGG - Intergenic
1047731369 8:127731569-127731591 TAGTCAGAAGGCAACTTCCATGG + Intergenic
1049205357 8:141361078-141361100 TGGCCAGTTGGCCCCCGCCATGG - Intronic
1049850894 8:144829543-144829565 TGGCCAGAGGGCCCTCTACAGGG + Exonic
1049865404 8:144932373-144932395 TGGTGTGAAGTCCCCCTCCTGGG + Exonic
1050238922 9:3613542-3613564 TGGTCTAAATGCTCCCTCCATGG + Intergenic
1053413480 9:37930562-37930584 TGGTGAGGAGGCCCCCACCAGGG - Intronic
1053510866 9:38686832-38686854 AGTTCAGAAGGACCCCTCCGTGG - Intergenic
1054831890 9:69634322-69634344 TGGTCTAAATGCTCCCTCCATGG - Intronic
1056616650 9:88173511-88173533 AGGTCTGATGGCTCCCTCCATGG - Intergenic
1058264633 9:102883132-102883154 TGTTCTAAAGGCTCCCTCCATGG + Intergenic
1059526469 9:114995650-114995672 AGGTCAGAAGGCCCACTTCTAGG + Intergenic
1060781938 9:126419353-126419375 TGCTCAGAAGGGCCCCACCATGG + Intronic
1060852107 9:126886640-126886662 TGCTCAGCAGGCCTCCTCTAGGG + Intergenic
1062265128 9:135683476-135683498 GGGACAGCAGGCCCCCTGCAGGG + Intergenic
1185449790 X:276017-276039 TGGTCAGAGGGGCCCTTGCAGGG - Intergenic
1188897353 X:35685916-35685938 TGGTCCAAATGCTCCCTCCATGG - Intergenic
1189325245 X:40107684-40107706 TGGTCAGGAGGCCCGCCCCGCGG - Intronic
1191145129 X:57157434-57157456 TGGTCTAAATGCTCCCTCCATGG + Intergenic
1191770892 X:64756974-64756996 TGGTCTAAATGCTCCCTCCATGG + Intergenic
1192793312 X:74405826-74405848 TGGTCTAAATGCTCCCTCCATGG - Intergenic
1193167976 X:78303133-78303155 TGGTTTAAATGCCCCCTCCATGG + Intronic
1193247282 X:79244063-79244085 TGGTCTAAATGCTCCCTCCATGG - Intergenic
1193293890 X:79810343-79810365 TGATCTGAATGCTCCCTCCATGG + Intergenic
1194340745 X:92701662-92701684 TGGTCTAAATGCTCCCTCCATGG + Intergenic
1194398099 X:93411544-93411566 TGGTCTATATGCCCCCTCCATGG - Intergenic
1194788612 X:98118309-98118331 TGGTCTAAATGCTCCCTCCATGG - Intergenic
1195535389 X:106003630-106003652 GGGCTAGCAGGCCCCCTCCAGGG - Intergenic
1195601238 X:106751369-106751391 TGGTCTAAATGCTCCCTCCATGG - Intronic
1195823217 X:108969844-108969866 TGGTCTAAATGCTCCCTCCATGG - Intergenic
1195834992 X:109103650-109103672 TGGTCTAAATGCTCCCTCCATGG + Intergenic
1196270171 X:113700358-113700380 TGGTCCAAATGCTCCCTCCATGG + Intergenic
1196639144 X:118038587-118038609 TGGTCTAAATGCTCCCTCCATGG - Intronic
1196960355 X:120993800-120993822 TGGTAAGGAGGCCCTCTTCAAGG - Intergenic
1197380919 X:125737439-125737461 TGGTCTAAATGCTCCCTCCATGG + Intergenic
1197514687 X:127411178-127411200 TGGTCTAAATGCTCCCTCCAAGG + Intergenic
1197707690 X:129646388-129646410 AGGGGAGAAAGCCCCCTCCAAGG + Exonic
1198956340 X:142135843-142135865 TGGTTTGAATGCTCCCTCCATGG - Intergenic
1199568897 X:149247167-149247189 TGGTCAAAAAGCTCTCTCCACGG + Intergenic
1200649100 Y:5818394-5818416 TGGTCTAAATGCTCCCTCCATGG + Intergenic
1201283302 Y:12359247-12359269 TGGTCAGGAGCCCTCCTCCATGG - Intergenic