ID: 963525629

View in Genome Browser
Species Human (GRCh38)
Location 3:146411042-146411064
Sequence CTGTGTGAATGGTGTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 0, 2: 6, 3: 55, 4: 521}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963525629_963525632 8 Left 963525629 3:146411042-146411064 CCATCCACACACCATTCACACAG 0: 1
1: 0
2: 6
3: 55
4: 521
Right 963525632 3:146411073-146411095 ACAGTTTTTTTTTTCTTTCCCGG 0: 2
1: 4
2: 35
3: 285
4: 2274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963525629 Original CRISPR CTGTGTGAATGGTGTGTGGA TGG (reversed) Intronic
900114434 1:1022452-1022474 CTGTGTGGAAGGTGCGTGGTGGG + Exonic
901312069 1:8277075-8277097 ATGTGTGTGTGGTGTGTGTATGG - Intergenic
901417992 1:9129865-9129887 CTGTGTGTGTTGTGAGTGGAAGG + Intergenic
901745962 1:11373634-11373656 GTGTGTGTGTGGTGTGTGGATGG + Intergenic
901746037 1:11374355-11374377 TGGTGTGTGTGGTGTGTGGATGG + Intergenic
901799278 1:11698061-11698083 CTGTGTGGTTTGTGTGTGGGTGG - Intronic
902815309 1:18913237-18913259 CTGTGGGAATGGCTTTTGGAGGG - Intronic
903969073 1:27107382-27107404 GTGTGTGTGTAGTGTGTGGAGGG - Intronic
904325381 1:29724471-29724493 CTTTGTTCAGGGTGTGTGGAGGG + Intergenic
904377239 1:30089670-30089692 CTGTGTGAATTGTCCTTGGACGG - Intergenic
904391333 1:30188254-30188276 CTGTGGGAATGGTGTGACGCTGG - Intergenic
904487816 1:30839298-30839320 CTGTGTGGATGATGAGTGAATGG + Intergenic
904567009 1:31434273-31434295 CTGGCTGATTGGTGTGGGGAGGG - Exonic
904680251 1:32224051-32224073 CTCTGTGAATGGTGAGAGGCTGG + Exonic
907197315 1:52697522-52697544 CTGGGTGAAGGGTGTCAGGAGGG - Intronic
907400387 1:54221673-54221695 CTGAGTGTGTGGTGTGTGGGTGG - Intronic
907651155 1:56296067-56296089 ATGTGTGAATGGAGAGTGGATGG - Intergenic
908756857 1:67476898-67476920 CTTTGTGTATGGTGTGAGAAAGG - Intergenic
909520000 1:76557039-76557061 TTTTGTGAATGGTGTGAGGAAGG + Intronic
910549296 1:88457679-88457701 GTGTGTGATTGGTGTGTGTGTGG - Intergenic
911565103 1:99455160-99455182 GTGTGTGAATGTTGTTTTGATGG - Intergenic
911971480 1:104443365-104443387 CTGTGTGAAAGGTGGGAGGGGGG - Intergenic
912700291 1:111873223-111873245 CTGTGTGCATTGTGTGTGGAGGG + Intronic
914373721 1:147053101-147053123 CTGGGTGAATTTTGTGTGGGTGG - Intergenic
915048755 1:153044181-153044203 GTGTGTGAATGCTATGAGGATGG - Intergenic
915265560 1:154714344-154714366 TGGTGTGTATGGTGTGTGTATGG + Intronic
915325088 1:155077800-155077822 GTGTGTGTGTTGTGTGTGGATGG + Intergenic
915601382 1:156924857-156924879 CTGGGAGAACGGTGTGGGGAGGG + Intronic
916487623 1:165273400-165273422 CTGTGTGAATGGGCTTTGTATGG - Intronic
916674846 1:167056538-167056560 CTGTGAGAGTAGTGTGTGTATGG + Intronic
916854702 1:168737570-168737592 CTGTGTGGGTGGTGTGTGACAGG - Intergenic
916901310 1:169227071-169227093 CTGAGTGAATAGTATGTGCAAGG - Intronic
918234483 1:182566278-182566300 TTTTGTGTATGGTGTGAGGAGGG + Intergenic
920191258 1:204195442-204195464 GTGTGTGTATGTTGTGTGTATGG - Intronic
922130463 1:222772228-222772250 CTGTGTAAGTGTTGTGTGGGGGG + Intergenic
922585630 1:226733097-226733119 CTGTGTGAGTGGGGTGAGCAAGG + Intronic
922618911 1:226978919-226978941 GTGTGTGGTGGGTGTGTGGAGGG - Intronic
922997030 1:229972360-229972382 GTGTGTGAATTGTGTATGTATGG - Intergenic
923226739 1:231944656-231944678 CTGCGTTAAGGGTATGTGGAAGG - Intronic
924665631 1:246068774-246068796 CAGTGTGAATGGTTCTTGGAGGG + Intronic
1063378502 10:5569327-5569349 GTGTGTGGTTGGTGTGTGGTTGG + Intergenic
1064123634 10:12640464-12640486 CTGTGTGTATGTTGTATGGATGG + Intronic
1064710713 10:18121519-18121541 GTGTGTGTGTGGTGTGTGGTTGG + Intergenic
1065785543 10:29209979-29210001 GTGTTTGAATGGTGTTTGGCTGG - Intergenic
1067013058 10:42732429-42732451 CTGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067310773 10:45111641-45111663 CTGTGTGTGTGGTGTGTGGAGGG + Intergenic
1067421471 10:46154510-46154532 ATGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067506808 10:46860961-46860983 ATGTGTGTGTGGTGTGTGGAGGG - Intergenic
1069752005 10:70750819-70750841 ATTTGTGTATGGTGTGAGGAAGG - Intronic
1070179494 10:73999547-73999569 CTGTGTAAATAGTGTGTGTCAGG + Intronic
1070305449 10:75236278-75236300 ATATGTGAATTGTGTATGGAGGG + Intergenic
1070500172 10:77065288-77065310 GTGGATGTATGGTGTGTGGAGGG + Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070796673 10:79220753-79220775 CTGTGTGTATGGTGTGTGTGAGG + Intronic
1072510363 10:96117515-96117537 GTGTGTCAATGGTGTGTCAACGG - Intergenic
1073047224 10:100646677-100646699 CTGTTTTAATGGTGTGTGTGTGG - Intergenic
1074767894 10:116714036-116714058 GTGGGTGGATGGTGGGTGGATGG + Intronic
1076819323 10:132930829-132930851 CTGTGTGAGGAGTGTGGGGAAGG - Intronic
1076819341 10:132930891-132930913 CTGTGTGAGGAGTGTGGGGAAGG - Intronic
1077004864 11:349699-349721 GTGTGTGTATGGTGTGTGTGTGG - Intergenic
1077004880 11:349830-349852 GTGTGTGTATGGTGTGTGTGTGG - Intergenic
1077004909 11:350050-350072 GTGTGTGTATGGTGTGTGTGTGG - Intergenic
1077159597 11:1106613-1106635 ATGGGTGGATGGTGGGTGGATGG - Intergenic
1077357821 11:2126895-2126917 ATGGGTGGATGGTGAGTGGATGG + Intergenic
1077723650 11:4651678-4651700 CTTTGTGAATGGGGTCTGGCTGG + Intronic
1078027461 11:7710815-7710837 CTCTGTGAATGTTGTGGGGTGGG + Intergenic
1078535291 11:12168416-12168438 GTGTGTATATGGTGTGTGGGGGG - Intronic
1080366538 11:31580556-31580578 GTGTGTGTATGGTGTGTGAATGG - Intronic
1080686861 11:34523153-34523175 CTGTGTGTATGATGTGTGCATGG - Intergenic
1081602420 11:44504490-44504512 GTGTGTGAAGAGTGTATGGAGGG - Intergenic
1082694036 11:56337648-56337670 GTGTGTGCCTGCTGTGTGGAGGG - Intergenic
1084166961 11:67379578-67379600 CTGAGTGACGGGTGTGTGGAGGG + Intronic
1084494050 11:69493988-69494010 CTGTGTTCATGGCGTGTGGAGGG + Intergenic
1085200715 11:74700247-74700269 CTCTGTGATTGGTGTGTAGCAGG - Intronic
1087277939 11:96179161-96179183 TTGTTTGAAAGGTGTTTGGAAGG - Intronic
1088263273 11:107965300-107965322 GTGTGTGTATGTTGGGTGGAGGG + Intergenic
1089019961 11:115203319-115203341 GTGTGTGAATGCTCAGTGGAAGG + Intronic
1089303971 11:117515367-117515389 CTGTCTGGATGGTGTGTGACAGG - Intronic
1089585843 11:119508988-119509010 GTGTGTGTGTGGAGTGTGGAGGG + Intergenic
1089638209 11:119830055-119830077 CTGTGTGAATTGTGGTTGGGTGG + Intergenic
1089821707 11:121234419-121234441 CAGTATGAATGGTGTGTGAAAGG + Intergenic
1090263163 11:125337201-125337223 CAGTGTGAATGGCCTGTGGAAGG + Intronic
1091083082 11:132691214-132691236 CTATGTGAATTGTGAGTGAATGG + Intronic
1091332318 11:134739546-134739568 GTGTGTGTAAGGTGTGTGTATGG + Intergenic
1091560000 12:1604985-1605007 GTGTGTGAGGGGTGTGTGTAGGG + Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092076852 12:5681077-5681099 CTGTGTGCAGGTTGTGTGGCAGG - Intronic
1092911506 12:13149115-13149137 CTGTGTGTGTGGTGTGTAGGAGG + Intergenic
1094256785 12:28439526-28439548 TTTTGTGTATTGTGTGTGGAGGG - Intronic
1094278543 12:28708060-28708082 TTGTGTCAATGGAGCGTGGATGG - Intergenic
1094819011 12:34210682-34210704 CTGAGTGACTCCTGTGTGGATGG + Intergenic
1095446699 12:42289170-42289192 CTGGGTGAATTTTGTGTGGGTGG - Intronic
1095939852 12:47718884-47718906 CTGTTTGTTGGGTGTGTGGAGGG - Intronic
1096079598 12:48824815-48824837 GTGTGGGAAGGGTTTGTGGAGGG + Intronic
1096086597 12:48869214-48869236 GTGGATGAATGGTGTGTGTAGGG - Intergenic
1097145388 12:56936191-56936213 CTGTGTGCATGGGGTGGGGATGG - Intergenic
1097719282 12:63002730-63002752 CTGTATGCATGGTGTGGGGTTGG + Intergenic
1098071442 12:66679909-66679931 CTTTGTGAATGGATTGTGAAGGG - Intronic
1098190757 12:67945931-67945953 CTGTGAGGATGGTATGTGGGAGG - Intergenic
1098231797 12:68378681-68378703 CTGTGGGAATGGTGGGAGTAGGG - Intergenic
1099517073 12:83610205-83610227 CTCTGAGAATGGTCTCTGGATGG + Intergenic
1099541945 12:83922108-83922130 CTGAGTGAGTGGTGAGTGAATGG - Intergenic
1099929542 12:89057858-89057880 CTGTTTTTATGGGGTGTGGATGG + Intergenic
1100917293 12:99439148-99439170 CTTTGTGTATGGTGTGAGGTGGG - Intronic
1101766176 12:107701606-107701628 TTGTGTGTATGGTGTGAGGTAGG + Intronic
1101845957 12:108363167-108363189 GTGTGTGCATGGTGTGTGTGTGG + Intergenic
1102042380 12:109809097-109809119 ATGGGTGAATGGTGGGTGGGTGG - Intronic
1102292070 12:111708954-111708976 CTGTCTAAATGGAGTATGGATGG + Intronic
1102339503 12:112110480-112110502 CTGGGAGAAGGGTGTGTGGCAGG - Intergenic
1102640254 12:114360735-114360757 ATGGGTGAATGGTGGGTGGATGG + Intronic
1103051061 12:117780000-117780022 GGGTGTGAATTCTGTGTGGATGG - Intronic
1103052583 12:117793292-117793314 GTGTGTGCATGTTGTGTGTATGG - Intronic
1103797113 12:123510919-123510941 GTGTGTGTGTGGTGTGTGTAAGG + Intronic
1103797168 12:123511594-123511616 CTGTGTGTGTGGTGTGTGTGAGG + Intronic
1104961368 12:132489978-132490000 CTGCGTGAATGGGGCGGGGAGGG + Exonic
1105458995 13:20566824-20566846 CTGTGTGAAGGGGGCGGGGAGGG - Intergenic
1106044877 13:26129639-26129661 CAGTGTGACTGCTGTGTAGAGGG - Intergenic
1106192350 13:27464477-27464499 CTGTATGCATTGTGTGTGCAGGG - Intergenic
1106322260 13:28652396-28652418 CTGTGTGAAAGGTGTGGTGGTGG - Intergenic
1107776110 13:43843742-43843764 CTTTATGAATGGTGTGAGGTAGG - Intronic
1110069405 13:71154634-71154656 CTTTGTGTATGGTGTTAGGAAGG + Intergenic
1110094016 13:71492771-71492793 GTGTGTGTATGGTGTGAGGGAGG + Intronic
1110367558 13:74704236-74704258 CTTTGTGAAGGGTGAGAGGAGGG - Intergenic
1110828553 13:80002295-80002317 CTGTGTGTATGTTGAGGGGAGGG - Intergenic
1110839695 13:80127808-80127830 CTGAGTGACTGAGGTGTGGAGGG + Intergenic
1111753686 13:92365407-92365429 ATGAGTGAGTGGTGAGTGGATGG + Intronic
1111875674 13:93891886-93891908 TTGTGTGTATAGTGTGTGTATGG + Intronic
1112063049 13:95761346-95761368 CTGTGTGAGTGTTGTTTGTAGGG + Intronic
1112150310 13:96752939-96752961 TTTTGTGAATGGTGTGAGGTAGG + Intronic
1113406281 13:110043509-110043531 CTGTGTGCATGGTGTATGTGTGG - Intergenic
1113406283 13:110043547-110043569 CTGTGTGTGTGGTGTGTGTGTGG - Intergenic
1113406292 13:110043718-110043740 GTGTATGAATGGTGTGTGGGGGG - Intergenic
1113406297 13:110043729-110043751 CTGTGTGTATGGTGTATGAATGG - Intergenic
1113533155 13:111044122-111044144 ATGTGTGTATGGTGTGTGTGTGG - Intergenic
1113607550 13:111621271-111621293 CTGTGTGTGTGGTGTGTGTGTGG + Intronic
1114410683 14:22497545-22497567 CTGTGTGACTGCTGTGTGATTGG + Intergenic
1115465486 14:33709896-33709918 CTGTGTGCACAGTGTGTGGGAGG - Intronic
1115898746 14:38120652-38120674 ATGTGGAAATTGTGTGTGGAAGG - Intergenic
1116493803 14:45536782-45536804 CTCTGTGAATGGAGTGTCCAGGG - Intergenic
1118441682 14:65817556-65817578 GTGTGTGTATGGTGTGTGTATGG - Intergenic
1118441685 14:65817634-65817656 GTGTGTGTATGGTGTGTGTATGG - Intergenic
1118441693 14:65817806-65817828 GTGTGTGTATGGTGTGTGTATGG - Intergenic
1118441696 14:65817882-65817904 TGGTGTGTATGGTGTGTGTATGG - Intergenic
1118441702 14:65817975-65817997 CTCTGTGTGTGGTGTGTGTATGG - Intergenic
1119492503 14:75048692-75048714 CTGTGAGTATGATGTGTGCATGG - Exonic
1120553525 14:85901706-85901728 CCCTGTGAATGGGGTGTGGGAGG + Intergenic
1120671828 14:87371471-87371493 CTGTGTGAGTGGAGTCTTGAAGG + Intergenic
1121171734 14:91860139-91860161 CTTTGGAAATGGTGTATGGAGGG - Intronic
1121605459 14:95236875-95236897 TTGTGGGAATGGTGTGGGGAGGG + Intronic
1121627597 14:95397765-95397787 GTGTGTGTTTGGTGTGTGGGGGG + Intergenic
1121661175 14:95636202-95636224 GTGTGTGAAGCGTGTGTGGTGGG + Intergenic
1122600752 14:102920542-102920564 GTGAGTGAATGATGGGTGGATGG - Intergenic
1123945153 15:25235381-25235403 GTGTCTGAGAGGTGTGTGGATGG + Intergenic
1124007249 15:25804247-25804269 CTATGTGCATGGTGTGTGTGTGG + Intronic
1124007261 15:25804446-25804468 CTGTGTGCATGGTGTGTGTGTGG + Intronic
1124168512 15:27351075-27351097 GTGTGTGTATAGTGTGTGTATGG + Intronic
1124168533 15:27351469-27351491 ATGTTTGTATGGTGTGTGTATGG + Intronic
1124517124 15:30376142-30376164 GTGTGTGAGTGGTGTGTGTGAGG + Intronic
1124725820 15:32154856-32154878 GTGTGTGAGTGGTGTGTGTGAGG - Intronic
1125362684 15:38880592-38880614 CTGTGTGACTAGGGTGGGGAAGG + Intergenic
1128332780 15:66766707-66766729 CTGTGTGATAGGTGAGAGGAGGG - Intronic
1128761605 15:70219815-70219837 CTTTGTGAAGGGTGTCTGCAAGG + Intergenic
1129337889 15:74864706-74864728 CTGTGGGATTGATGTGAGGAAGG - Intronic
1129359072 15:75013046-75013068 CTCTGTGAAAGGAGGGTGGAGGG - Intronic
1129660145 15:77548820-77548842 CTGTGTGAAGGGTGGGGGAAGGG + Intergenic
1131983497 15:98018179-98018201 CCTTGTGAATGGTGCCTGGATGG + Intergenic
1132112496 15:99112529-99112551 CTGTGTGACTTGTATGTGGTGGG + Intronic
1132952472 16:2571484-2571506 TTTTGTGTATGGTGTGAGGAAGG - Intronic
1132961879 16:2628686-2628708 TTTTGTGTATGGTGTGAGGAAGG + Intergenic
1135845485 16:25914589-25914611 GTATGTGTATGGTGTGTGTAGGG + Intronic
1135951013 16:26914116-26914138 CTGAGTGAATGGTGGGAGAACGG + Intergenic
1136115029 16:28089063-28089085 GTGTGTGTGTGGTGTGTGGGGGG - Intergenic
1138595704 16:58027861-58027883 CTGTGTGAATGGGGTGGGGGAGG - Intronic
1139427795 16:66894028-66894050 CTGGGAGAGTGGTCTGTGGAGGG + Intronic
1140197445 16:72866826-72866848 CTGTGTGGATGGTGAATGGGTGG - Intronic
1140246144 16:73251884-73251906 GTGTGTGCATGGTGTGTGTGTGG - Intergenic
1141096804 16:81168600-81168622 ATGGGTGGATGGTGGGTGGATGG + Intergenic
1141158778 16:81615377-81615399 GTGTGTGTATGGTGTGTGTGTGG + Intronic
1141158796 16:81615729-81615751 GTGTGTGTATGGTGTGTGTGTGG + Intronic
1141160536 16:81626549-81626571 ATGTGTGTGTGGTGTGTGGGTGG + Intronic
1141160545 16:81626611-81626633 GTGTGTGTGTGGTGTGTGGGTGG + Intronic
1141424321 16:83935493-83935515 CTGTGTGGAGGGTGTGTTGGGGG + Intronic
1141800143 16:86302340-86302362 GTATGTGGATGGTGGGTGGATGG - Intergenic
1142012325 16:87721957-87721979 CTTTGGAAATGGTGTTTGGATGG - Intronic
1203141176 16_KI270728v1_random:1767805-1767827 CTGTGTTACTGGTGGGAGGAGGG + Intergenic
1142744095 17:1946805-1946827 CTGTGTGAATTGTGTGTGCACGG + Intronic
1143478436 17:7215931-7215953 CTGGATGCCTGGTGTGTGGAGGG - Intronic
1143867733 17:9936115-9936137 TTGTGTGTATGGTGTGAGGTAGG - Intronic
1144146229 17:12401135-12401157 CTATTTCAATGGTGTTTGGAAGG - Intergenic
1144792832 17:17870918-17870940 CTGTGTGAGTGCTGTGTTGCAGG - Intronic
1145406392 17:22600255-22600277 CTGTGTGTATGATGTCTGGATGG - Intergenic
1145413559 17:22694592-22694614 CTGTGTGACTGGTGCGGGGAGGG - Intergenic
1146798374 17:35798937-35798959 CTGTGTGGATGCTGGGAGGATGG + Intronic
1146936863 17:36817468-36817490 CTGTGTGAAAAGTGTGGGTATGG - Intergenic
1147150684 17:38511816-38511838 CTGTGTGCCTGGGCTGTGGAAGG - Exonic
1147888037 17:43697718-43697740 CTGTGAGGAAGGCGTGTGGAAGG + Intergenic
1148744060 17:49908657-49908679 CTGTGGGAATGGGGAGTGGGCGG + Intergenic
1149054511 17:52347031-52347053 CTGTGTGCAAGGTGGGTGGGGGG + Intergenic
1149458661 17:56809976-56809998 GTGTGTGAAGGGTCTGTGCAAGG - Intronic
1149458698 17:56810176-56810198 GTGTGTGAAGGGTGTGTTCAAGG - Intronic
1149652828 17:58287642-58287664 TTGTGTGAATGGTATGAGGTGGG + Intergenic
1149762031 17:59240853-59240875 CTGAGTGAGTGGTGAGTGAATGG - Intronic
1152130379 17:78472624-78472646 CTGTGTGTGGGGTGTGGGGAGGG + Intronic
1152267100 17:79301517-79301539 CTGTGAGACTGGCCTGTGGATGG - Intronic
1152285799 17:79412246-79412268 GTGAGTGTATGGTGTGTGTATGG + Intronic
1152317990 17:79591823-79591845 ACGTGTGGAGGGTGTGTGGAGGG + Intergenic
1152318002 17:79591881-79591903 ACGTGTGGAGGGTGTGTGGAGGG + Intergenic
1152318009 17:79591910-79591932 ATGTGTGGAGGGTGTGTGGAGGG + Intergenic
1153245276 18:3067212-3067234 CTGTGTGACTTGGGTGTGAATGG - Exonic
1153835911 18:8963575-8963597 GTGTGTGTGTGGTGTGTGTATGG - Intergenic
1155822933 18:30401157-30401179 ATGAGTGAATGGTGAGTGAATGG - Intergenic
1155963987 18:32019085-32019107 CTGAGGGCATGGTGTGGGGAAGG + Intronic
1156842364 18:41624367-41624389 CTTTTTGAAAGGAGTGTGGATGG + Intergenic
1157574005 18:48731589-48731611 ATAAGTGAAAGGTGTGTGGATGG + Intronic
1157898000 18:51486772-51486794 CTGTGTGAATGGGTTGCTGAAGG + Intergenic
1158274318 18:55749951-55749973 ATGTGTGAGTGATGTCTGGATGG - Intergenic
1159090250 18:63840170-63840192 CTGTGTGTATGATGTGAGCAGGG - Intergenic
1160240426 18:77118884-77118906 CTGTGTGTGTGGTGTGTGTCTGG - Intronic
1160253148 18:77221588-77221610 TTGGGTGAGTGGTGGGTGGAAGG - Intergenic
1160400376 18:78606519-78606541 GTGTTTGTATGGTGTGTGTATGG - Intergenic
1160404921 18:78638853-78638875 GTGTGTGTGTGGTGTGTGGGTGG - Intergenic
1161347764 19:3776673-3776695 ATGAGTGGATGGTGGGTGGATGG + Intergenic
1161641095 19:5423824-5423846 ATGGGTGAATGGTGGATGGATGG - Intergenic
1162672422 19:12268187-12268209 CTTTGTGACTGGGGTGGGGAAGG - Intronic
1163067493 19:14809776-14809798 CTGTGGGAAAGTTTTGTGGAGGG - Intronic
1163197218 19:15731205-15731227 CTTTGTGTATGGTGTGAGGTAGG + Intergenic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163834126 19:19563003-19563025 CTGTGTGTGTGGTGTGTGCCAGG - Intronic
1163927925 19:20363051-20363073 CTGTGTGAATGGTGAGTGATTGG + Intergenic
1164220097 19:23185702-23185724 CTGTGTGAATGGTGAGTGAGTGG - Intergenic
1164235454 19:23328802-23328824 CTGATTGGATGGTGTGGGGAAGG + Intronic
1164462049 19:28457341-28457363 CTGTCTGAATCATGTGTGCAGGG + Intergenic
1164524985 19:29007060-29007082 GTGTGTGTCTGGTGTGTGGGGGG - Intergenic
1164676375 19:30104304-30104326 CTGTGGAGAGGGTGTGTGGAGGG - Intergenic
1164711344 19:30359270-30359292 CAGTGTGCATGGTGTGGGGAGGG + Intronic
1165149786 19:33753774-33753796 GTGTGTGGGTGGTGTGGGGATGG - Intronic
1165354919 19:35298410-35298432 TTGTGTGTGTGGTGTGTGCATGG - Intronic
1165523098 19:36329908-36329930 CTGTGTGAATGGTGAATGAATGG - Intergenic
1165699089 19:37923573-37923595 GTGAGTGAGTGGTGAGTGGATGG + Intronic
1165965240 19:39572186-39572208 TTTTGTGAATGGTGTAAGGAAGG + Intergenic
1166302352 19:41918529-41918551 GTGTGTGTATGGTGAGTGTATGG - Intronic
1166315178 19:41985547-41985569 GTGGGTGAGTGGTGTGTGGGAGG + Intronic
1166344146 19:42154994-42155016 GTGTGTGGACTGTGTGTGGAGGG - Intronic
1166571978 19:43802730-43802752 CTGTGTGGGTGGTGTGTGTTGGG - Intronic
1166745899 19:45141745-45141767 CTGTGTGAAGGCTGGGTGGAGGG + Intronic
1166877128 19:45904049-45904071 CTGTGTGGAGGGTGGGTGGGAGG + Intergenic
1167288843 19:48613761-48613783 CTGTGTGACTGGTGGGTTGGAGG - Intronic
1167450049 19:49561989-49562011 TTTTGTGTATGGTGTGAGGAAGG + Intronic
1167631362 19:50628154-50628176 CTGTGTGTGTGTTGTGGGGAGGG - Intronic
1168014296 19:53558956-53558978 ATGTGTGTATGGTGTGTATATGG - Intronic
1168128562 19:54301619-54301641 CTGTGTGAACGCTGTGCTGAAGG - Intergenic
1168305787 19:55434414-55434436 GTGTGTGTATGGTGTGTGTGTGG + Intronic
1168305793 19:55434467-55434489 GTGTGTGTATGGTGTGTGTGTGG + Intronic
1168305802 19:55434566-55434588 GTGTGTGTATGGTGTGTGTGTGG + Intronic
1168305855 19:55435092-55435114 GTGTGTGTATGGTGTGTGTGTGG + Intronic
1168305864 19:55435194-55435216 ATGTGTGTGTGGTGTGTGTATGG + Intronic
1168684555 19:58340358-58340380 CCGTGTGGCTGGTGTATGGAAGG - Exonic
925160411 2:1679811-1679833 GTGTGTAAATGGTGTGTGTGTGG + Intronic
925160416 2:1679899-1679921 GTGTGTAAATGGTGTGTGTGTGG + Intronic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
926050346 2:9740377-9740399 CTATGTGACAGGTGGGTGGATGG - Intergenic
926111903 2:10189001-10189023 CTGAGTGATTGATGTGTGGGAGG - Intronic
926152629 2:10433266-10433288 GTGTGGGAATGGTGTGGGGATGG + Intergenic
926166134 2:10522947-10522969 CTGAGTGAAGGCGGTGTGGATGG + Intergenic
927282967 2:21326857-21326879 CTGAGGGGATGGTGTGTAGATGG - Intergenic
927485407 2:23485367-23485389 CTGTCTAAATTGTGTGTGAAAGG + Intronic
928890859 2:36201453-36201475 CTGAGTGAAGGGTGTGCTGAAGG - Intergenic
929195252 2:39178012-39178034 CAGTGTGAATTGTGTGTAAAAGG - Intronic
929407822 2:41663250-41663272 CTGTGTGAACCGTGTCTGGAGGG - Intergenic
929608648 2:43253279-43253301 CTGTGTGAAGGATGTGTGCAGGG + Intronic
932097012 2:68859814-68859836 CTGTGTGAATGGTCTGAGGAAGG + Intergenic
932401387 2:71483124-71483146 ATGGGTGCATGGTGTGGGGAGGG + Intronic
932957451 2:76370380-76370402 TTGAGTTAATGGTGTGGGGAAGG + Intergenic
933040916 2:77465577-77465599 TTGTGAAAATGGTGTGGGGAAGG + Intronic
933994063 2:87655059-87655081 CTGTGTGACTGGTGGGATGAAGG + Intergenic
934779272 2:96959304-96959326 GTGAGTGATGGGTGTGTGGAGGG + Intronic
936089723 2:109493535-109493557 GTATGTGTATGGTGTGTGAAGGG - Intronic
936253754 2:110890481-110890503 TTTTGTGTATGGTGTGAGGAAGG + Intronic
936299801 2:111295851-111295873 CTGTGTGACTGGTGGGATGAAGG - Intergenic
936341489 2:111637435-111637457 TTGTGTGTATGGTGTGAGGTAGG - Intergenic
937347347 2:121134469-121134491 ATGTGTGTGTGGTGTGTGGGGGG + Intergenic
938284775 2:130102689-130102711 CTGAGTGAATGCTGAGGGGAAGG - Intronic
938335416 2:130491249-130491271 CTGAGTGAATGCTGAGGGGAAGG - Intronic
938354408 2:130629418-130629440 CTGAGTGAATGCTGAGGGGAAGG + Intronic
940507653 2:154577066-154577088 CTGTGTGACTGGTGAGTGAGTGG - Intergenic
941026859 2:160465833-160465855 GTGTGTGTGTGGTGTGGGGAGGG - Intronic
941695502 2:168546874-168546896 CTGTGTGAATGAGGTGCTGAAGG - Intronic
941852809 2:170201105-170201127 CTCTGAGAATTGTGTATGGAAGG - Intronic
942306354 2:174611157-174611179 CTGCGTTGATGATGTGTGGAAGG + Intronic
942963320 2:181859333-181859355 CTGTTTGCACGGTGTCTGGATGG - Intergenic
943666670 2:190616172-190616194 ATGTGTGGATGGAGTGAGGAGGG + Intergenic
944290438 2:197998401-197998423 ATGTGTGAGGGGTGTGTGTAGGG + Intronic
944537062 2:200721316-200721338 TTTTGTGTATGGTGTGAGGAAGG - Intergenic
944757762 2:202781634-202781656 GTGTGTGAATAGTGACTGGAAGG - Intronic
945746314 2:213723239-213723261 CTGTGTGGATGGCATGTGGCTGG + Intronic
946187602 2:217989866-217989888 CTGTGTGGAGGGTTTGTGGCAGG - Intronic
946187614 2:217989956-217989978 GTGTGTGGCTGGTGTGTGGATGG - Intronic
946187638 2:217990118-217990140 GTCTGTGGCTGGTGTGTGGATGG - Intronic
946187660 2:217990280-217990302 GTGTGTGGATGGTATGTGGCTGG - Intronic
946187662 2:217990291-217990313 GTGTGTTGCTGGTGTGTGGATGG - Intronic
946187690 2:217990445-217990467 GTGTTTGAAGGGTGTGTGGCTGG - Intronic
947110669 2:226715831-226715853 GTGTGTGTATGGGGTGTGTATGG + Intergenic
947299450 2:228672756-228672778 TTTTGTGTATGGTGTGAGGAAGG + Intergenic
947832417 2:233150918-233150940 CTGAGAGAATGGGGTGTGCAGGG + Intronic
948166670 2:235867866-235867888 CTGGGTGGGTGGTGGGTGGATGG - Intronic
948563785 2:238870901-238870923 GTGTGTGTGTGGTGTGTGGGAGG - Intronic
948563805 2:238870972-238870994 GTGTGTGTGTGGTGTGTGGGAGG - Intronic
948563924 2:238871549-238871571 GTGTGTGTGTGGTGTGTGGGAGG - Intronic
948791889 2:240383503-240383525 CTGTGTGGATGGGGAGTGGCAGG - Intergenic
1168910165 20:1440950-1440972 CTGTGTTGAGGGTGTGTGGCTGG - Intergenic
1170156008 20:13269973-13269995 ATATGTGAATGGAGTATGGATGG + Intronic
1170233129 20:14072254-14072276 GTGTGTGTATGGGGTGTGGTGGG + Intronic
1170241904 20:14175368-14175390 CTGTGCTAATGAAGTGTGGAGGG + Intronic
1170966801 20:21080624-21080646 TTGTGTGAATGGTGTGAGGTAGG - Intergenic
1171896225 20:30812781-30812803 CAGTGTGACTCCTGTGTGGATGG - Intergenic
1172782776 20:37447135-37447157 CAGTGTGTGTGGTGTGTGAAAGG + Intergenic
1172894042 20:38286987-38287009 GTGTGTGCATGGTGTGGGGTAGG + Intronic
1172904125 20:38356225-38356247 CTGTGTGTAGGGTGTGTGTGTGG - Intronic
1173124432 20:40323664-40323686 GTGTGTGACTCATGTGTGGAGGG + Intergenic
1173350086 20:42236888-42236910 CTGTGTGAATAGAATGTGGTAGG + Intronic
1173571102 20:44076600-44076622 CTGTGTGAAAGGCCTGTGCAGGG - Intergenic
1173826252 20:46049554-46049576 GTGGGTGTATGGTGTGTGGATGG + Intronic
1175548859 20:59802606-59802628 CTGTGTGCAGGGAGCGTGGAAGG + Intronic
1175720474 20:61283629-61283651 GTGTGTGTGTGGTGAGTGGATGG + Intronic
1175793189 20:61755288-61755310 CTGTGTGTGTGGTGTGTGTGGGG - Intronic
1175793207 20:61755460-61755482 CTGTGTGTATGGTGTGTGTGTGG - Intronic
1175799041 20:61790594-61790616 ATGGGTGGATGGTGGGTGGATGG - Intronic
1176095095 20:63337831-63337853 CAGTGTGGCTGGTGTGTGGGAGG + Intergenic
1176739210 21:10583718-10583740 CTATGTGTGTGGTGTGAGGAAGG + Intronic
1177551446 21:22627408-22627430 TTGATTGAATGGTGTGGGGAAGG + Intergenic
1177937332 21:27365943-27365965 CTTTGTGAATGTTCTGTGGTGGG + Intergenic
1178154363 21:29833756-29833778 GTGTGTGTGTGGTGTGTGTATGG - Intronic
1178245777 21:30950668-30950690 CTCTGTGTATGGTGTGAGGTAGG - Intergenic
1178599767 21:33985579-33985601 GTGTGTACATGGTGTGAGGAGGG - Intergenic
1179346500 21:40562486-40562508 CTGAGTGAGTGGTGTGTCTAGGG - Intronic
1179504176 21:41829063-41829085 GTGTGTGTGTGGTGTGTGTATGG - Intronic
1179620990 21:42616155-42616177 ATGTGTGTGTGGTGTGTGTATGG - Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179769597 21:43604731-43604753 GTGTGTGAGTGGTGTGTGTGTGG - Intronic
1179998281 21:44984029-44984051 GTGTGTGTAGGGTGTGTGTAGGG - Intergenic
1180141994 21:45898557-45898579 CTGTGAGGATGGCGTGTAGAGGG - Intronic
1180857027 22:19054355-19054377 CTGTGTAAATGGTGTATGAAAGG + Intronic
1180962883 22:19770293-19770315 TGGTGTGAAGGGGGTGTGGATGG - Intronic
1180986826 22:19909783-19909805 GTGTGTGAGTGGTGTGTGTGTGG - Intronic
1180986835 22:19909859-19909881 GTGTGTGAGTGGTGTGTGTGTGG - Intronic
1181597291 22:23924392-23924414 CTGTCTGAATGTTTAGTGGATGG + Intergenic
1181751209 22:24990490-24990512 GTGTGTGCATGGTGTGTGTGGGG - Intronic
1181751212 22:24990501-24990523 GTGTGAGCATGGTGTGTGCATGG - Intronic
1182980108 22:34661820-34661842 CAGTGGGTATGGTGTGGGGAAGG - Intergenic
1183062164 22:35342874-35342896 ATGTGTGTGTGGTGTGTGTAGGG - Intronic
1183062217 22:35343213-35343235 ATGTGTGTGTGGTGTGTGTAGGG - Intronic
1183062248 22:35343408-35343430 ATGTGTGTGTGGTGTGTGTAGGG - Intronic
1183062270 22:35343596-35343618 ATGTGTGTGTGGTGTGTGTAGGG - Intronic
1183319223 22:37154969-37154991 CAGTGTGAATTGTCTGAGGAGGG - Intronic
1183734766 22:39637910-39637932 CTTTGTGTATGGTTTGTAGATGG + Intronic
1184412855 22:44335627-44335649 GTGAGTGAATGGTGTGTGTGAGG + Intergenic
1184414770 22:44345823-44345845 CTGGGTGAATGATGGGTGGTGGG + Intergenic
1184565836 22:45291381-45291403 ATGTGTGTGTGGTGTGTGGGTGG + Intronic
1184591709 22:45488596-45488618 CTGTGTGATTTCTGTGTGAAGGG - Intergenic
1184744680 22:46449408-46449430 CTGTGTGATGGGTGGTTGGATGG - Intronic
1184951616 22:47847069-47847091 GTGAGTGAATGGAGAGTGGATGG + Intergenic
1185013882 22:48332429-48332451 GTGTGTGTATGGTGTGTGGGGGG - Intergenic
1185056723 22:48583415-48583437 CTGTGTGTGTGGTGTGTGTGTGG - Intronic
1185193357 22:49452694-49452716 GTGGGTGGATGATGTGTGGATGG + Intronic
1185281858 22:49973571-49973593 GTGTGTGTATGGGGTGTGTATGG + Intergenic
949523298 3:4877178-4877200 CAGTGTGAACGATGTGTGCATGG - Intronic
949565336 3:5239485-5239507 GTGTATGTATGGTGTGTGTATGG - Intergenic
949565340 3:5239547-5239569 GTGTGTGTATGGTGTGTGTATGG - Intergenic
949845238 3:8362970-8362992 CTATGTGGGTGGTGTGTGGTAGG + Intergenic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
951380756 3:21981733-21981755 TTTTGTGTATGGTGTATGGAAGG + Intronic
952591678 3:34962769-34962791 CTATGTGACTGGTGTGGGCAGGG - Intergenic
952647693 3:35681507-35681529 GTGTGTAAAGGGGGTGTGGATGG + Intronic
952729073 3:36620217-36620239 ATGTGTGAATAGTGTGTATAGGG - Intergenic
952777823 3:37063203-37063225 CTGTGTGAGTAGTGTTTAGAGGG + Intronic
952791291 3:37202669-37202691 CTGTGTGTTTTGTGTGTGGGTGG - Intergenic
952818967 3:37469382-37469404 CTGTGTGTGTGGTGGGTGGTAGG + Intronic
953006765 3:38986217-38986239 CAGTGTGGATGGTGTGGTGACGG - Intergenic
954535349 3:51355553-51355575 GTGTGTGAAAGGTGAGGGGAAGG - Intronic
954760719 3:52871660-52871682 CTGTGTGGAGGATGGGTGGATGG - Intronic
955614688 3:60794087-60794109 CTAGGTGAAGGGTGAGTGGAAGG - Intronic
959242335 3:103812958-103812980 CTTTGTGAATGGTTTGGGTAGGG + Intergenic
959544838 3:107582669-107582691 CTGTGTTAATGTTGTATTGATGG + Intronic
959886915 3:111513500-111513522 TTGTGTGAATGAAGTGTGGATGG - Intronic
961012694 3:123447135-123447157 CTGTGGGAATGCAGTGAGGAAGG - Intronic
961388761 3:126539526-126539548 CGGTGTGTGTGGTGTGTGCATGG - Intronic
961648823 3:128407435-128407457 CTGTGAGAATGGCGTGGGGCAGG + Intronic
961790233 3:129370876-129370898 GTGTGTGTGTGGTGTGTGTATGG + Intergenic
962149960 3:132882063-132882085 GTGTGTGTGTGGTGTGTGTATGG + Intergenic
962924451 3:139978692-139978714 GTGTGTGTGTGTTGTGTGGAAGG + Intronic
963146699 3:142001801-142001823 CTGTTTTAATGTTTTGTGGAAGG - Intronic
963525629 3:146411042-146411064 CTGTGTGAATGGTGTGTGGATGG - Intronic
964019892 3:151997025-151997047 CTGAGTGAATGCAGTGTGCAGGG - Intergenic
965908274 3:173738414-173738436 TTTTGTGCATGGTGTGAGGAAGG + Intronic
966625068 3:182006878-182006900 ATGTGTGTGTGGTATGTGGAGGG + Intergenic
966792381 3:183685468-183685490 CTGTCTTAATGGAATGTGGAGGG + Intergenic
966890855 3:184406512-184406534 CTGTGTGAGTGGGGTGCGGGGGG + Intronic
967309642 3:188093890-188093912 CTGTGTGCAGGGTGTAGGGATGG + Intergenic
967703117 3:192617876-192617898 ATGTCTGGATTGTGTGTGGAGGG - Intronic
967884656 3:194325056-194325078 GTGTGTGTCTGGTGTGTGTATGG - Intergenic
968234690 3:197024564-197024586 CTGTGGGAGAGGTGTGTGCACGG + Intronic
968598379 4:1496986-1497008 ATGTGTAAATGATGGGTGGATGG + Intergenic
968598405 4:1497159-1497181 ATGTGTAAATGATGGGTGGATGG + Intergenic
968620436 4:1601375-1601397 CTGTGTGAACGGTGGACGGATGG - Intergenic
969704628 4:8785033-8785055 TTGTGGGAAGGGTGGGTGGAGGG - Intergenic
969832169 4:9806664-9806686 CTGTGTGCATGGGGGGTGGGAGG + Intronic
970019533 4:11551824-11551846 TTTTGTGAATGGTGTGAGGTCGG + Intergenic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
971237092 4:24852273-24852295 GTGTGTGTATGGTGTGTTGGAGG - Intronic
972250430 4:37294199-37294221 CTGTTTCAATGGTGTAGGGAAGG - Intronic
972406779 4:38753752-38753774 CTGTGTGTATGGGGTGTGTGTGG - Intergenic
972406827 4:38754330-38754352 GTGTGTGTATAGTGTGTGGGAGG - Intergenic
975050252 4:69854751-69854773 CTGTGTGCATGGTATTGGGATGG - Intronic
977571149 4:98631265-98631287 CAGTGTGAATGTTGTCTGTAGGG - Intronic
977580036 4:98714805-98714827 GTGTGTGGATCGAGTGTGGAAGG - Intergenic
977595337 4:98873434-98873456 TTGGGTGAATGGTTTGTGCATGG - Intronic
977988261 4:103411438-103411460 CTGTGTGAAATATGTGTGGGTGG + Intergenic
979372308 4:119903841-119903863 TTATGTGTATGGTGTGGGGAGGG - Intergenic
982695730 4:158597810-158597832 CTGTGTGTATGCTGTGGGGATGG - Intronic
983518190 4:168678805-168678827 ATGTGGGTATGGTGTGTGGGGGG + Intronic
983518250 4:168679158-168679180 GTGTGTGCATGGTGTGTGGTGGG + Intronic
983518267 4:168679242-168679264 GTGTGTGTGTGGTGTGTGGTGGG + Intronic
983587676 4:169373386-169373408 CTGGGTGAGTGGTGAGTGAATGG + Intergenic
983613098 4:169671748-169671770 GTGTGGGGAAGGTGTGTGGAGGG + Intronic
984876612 4:184373833-184373855 CTTTGTGCATGCTCTGTGGAAGG + Intergenic
985547489 5:517203-517225 ATGCGTGAATGGTTGGTGGATGG - Intronic
985662960 5:1166439-1166461 ATGGATGAATGGTGGGTGGATGG - Intergenic
985727869 5:1525127-1525149 CTCTGTGCATGATATGTGGATGG - Intergenic
986483069 5:8208985-8209007 CTGTGTGTATGGAGTGTGTGTGG + Intergenic
986589824 5:9357033-9357055 CTGTGTGAATGGGCTCAGGAAGG - Intronic
988312075 5:29572406-29572428 ATGTGTGACTGGTGTTTAGAAGG + Intergenic
988379699 5:30484476-30484498 CTATGTAAATGGTGGGTTGATGG - Intergenic
990271480 5:54146149-54146171 TTGTGTGTATGGTGTGAGGCAGG - Intronic
990334931 5:54763441-54763463 TTGCGCGAATGGTGTGGGGAGGG - Intergenic
992210010 5:74469517-74469539 GTGTGTGATTGGTGTGTTCAAGG - Intergenic
993536038 5:89087674-89087696 CTGTGTTGATGGGGTGGGGAAGG - Intergenic
993833663 5:92789821-92789843 GTGTGTGAAGGGTGAGAGGAGGG - Intergenic
993885464 5:93410622-93410644 TTCTGTGGATGGTGTGGGGATGG - Intergenic
994113048 5:96030137-96030159 CTGTCTAAATAGTGTGTTGATGG - Intergenic
994728356 5:103462844-103462866 CAGTGTGAATGCTGTGAGGTGGG - Intergenic
995687337 5:114785028-114785050 CTATCTGAAGGGAGTGTGGATGG - Intergenic
995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG + Intronic
998368346 5:141645263-141645285 TTGTGTACATGGTGAGTGGATGG - Intronic
999987669 5:157020233-157020255 GTGTGTGTATTGTGTGAGGAAGG + Intergenic
1000613676 5:163404127-163404149 CTTTCTGAATGTGGTGTGGAGGG + Intergenic
1000820737 5:165980087-165980109 CTAACAGAATGGTGTGTGGATGG + Intergenic
1001001449 5:168011221-168011243 CTGTGGGAATGATGTGCAGATGG + Intronic
1001218974 5:169883083-169883105 CTCTGTGCCTGGTGTGTGGCTGG + Exonic
1001332580 5:170772699-170772721 GTGTGTGATGGGTGTGGGGAAGG + Intronic
1001963562 5:175894917-175894939 CTGTGGGAGTTGTGTGTTGAGGG - Intergenic
1002279815 5:178123646-178123668 CTGTGGGGATGGTGTGTTTATGG + Exonic
1002444659 5:179282310-179282332 ATTTGTGTATGGTGTGAGGAAGG + Intronic
1002589808 5:180282730-180282752 CTGTGTTGCTGGTGTGTTGACGG - Intronic
1003161546 6:3638881-3638903 TTGTGTGTATGGTGTGAGGTAGG - Intergenic
1004005247 6:11632146-11632168 CTATTTGAATTGTATGTGGAGGG - Intergenic
1004825552 6:19416787-19416809 CTCTGTGTATGGTGTGAGGAAGG + Intergenic
1004856739 6:19758661-19758683 ATGTGTAACTGCTGTGTGGAAGG - Intergenic
1005093634 6:22086298-22086320 TTTTGTGAATGGTGTGAGGTAGG - Intergenic
1005164798 6:22907386-22907408 CTGGGTGAAAAGTGTGTGTAGGG - Intergenic
1005206317 6:23409498-23409520 CTGTGTGGAAGGTGTGTGGGTGG - Intergenic
1006407476 6:33853557-33853579 CTGAGTGAGTGGTGGGTGCAGGG + Intergenic
1007369401 6:41416519-41416541 GTGTGTGTCTGGTGGGTGGAGGG - Intergenic
1007697742 6:43744433-43744455 ATGTGTGTATTGTGTGGGGAGGG + Intergenic
1008112929 6:47512383-47512405 CTGTGAATATGGAGTGTGGATGG + Intronic
1010958871 6:82122928-82122950 TGCTGTGAATGGTGTCTGGAGGG + Intergenic
1011164654 6:84432189-84432211 CTGAGTGAATGGTGGATGGATGG + Intergenic
1015017177 6:128427735-128427757 CTGTGTGGAGGCTATGTGGAGGG - Intronic
1016467167 6:144337100-144337122 CTGTGTGTGTTGTGTGTGGCAGG - Intronic
1016740360 6:147521679-147521701 CTGTGTGATTACTGTGTGGCAGG - Intronic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017731278 6:157318825-157318847 CTGTATGCATGGTGTGGGGTTGG - Exonic
1017918669 6:158853197-158853219 GTGTGTGCATGGTGTGTGTTTGG - Intergenic
1018134315 6:160764945-160764967 GTATGTGTATGGTGTGTGTATGG + Intergenic
1018346600 6:162905292-162905314 CTGTGTGAATGGAGTGGGAAGGG + Intronic
1018935296 6:168270094-168270116 GTGTGTGTATGGTGTGTGTGTGG - Intergenic
1018935297 6:168270105-168270127 GTGTGTATATGGTGTGTGTATGG - Intergenic
1018966415 6:168493477-168493499 TTTTGTGAATGATGTATGGATGG + Intronic
1019020678 6:168915014-168915036 ATGTGTGAATGCTCTGTGGATGG - Intergenic
1019074042 6:169372677-169372699 GTGTGTGTATGGTGTGTGTGTGG - Intergenic
1019813806 7:3184576-3184598 CTGTGTTGATCGTTTGTGGAGGG - Intergenic
1020014624 7:4823863-4823885 CTGTGAGAAAGATGTGTGGCTGG - Intronic
1020110739 7:5446544-5446566 ATGTTTTAATGGTTTGTGGAGGG + Intronic
1021912678 7:25401878-25401900 CTGTGTGCATGGTGGGGGAAGGG - Intergenic
1021981874 7:26063288-26063310 GTGTGTCAATGTTGTGTAGAAGG + Intergenic
1022759289 7:33329907-33329929 ATGTGTGAATTGTCTGTAGATGG + Intronic
1023344795 7:39260381-39260403 CTGTGTGTGTGGTGTGAGCAAGG - Intronic
1023344816 7:39260594-39260616 TTGTGTGTATGGTGTGTGTGTGG - Intronic
1024336807 7:48216753-48216775 TTTTGTGTATGGTGTGAGGAAGG + Intronic
1026361155 7:69601132-69601154 GTGTGTGCATGGTGTGTGGGGGG - Intronic
1026491182 7:70865310-70865332 TTCTGTGAATGGTGTGAGGTAGG + Intergenic
1027410508 7:77912599-77912621 CTTTGTGTATGGTATGTTGATGG + Intronic
1027557385 7:79682792-79682814 GTGTGTGTGTGGTGTGTGGAAGG + Intergenic
1028019986 7:85758432-85758454 CTTTGTGTATGGTGTAAGGAAGG - Intergenic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1029056481 7:97749985-97750007 TTTTGTGTATGGTGTGAGGAAGG - Intergenic
1030470795 7:109960049-109960071 CTCTGTGAATGGTGAGAGGCTGG - Intergenic
1031737798 7:125388665-125388687 CTGTGTGAAGGGCATGTGAATGG + Intergenic
1032023364 7:128422137-128422159 CTGTGTTTGTGGTGTGTGGGGGG + Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033600834 7:142887477-142887499 TTGTGTGTATGGTGTGTAGTGGG + Intergenic
1033723622 7:144087875-144087897 TTTTGTGCATGGTGTGTGGTAGG + Intergenic
1033723708 7:144088921-144088943 TTTTGTGCATGGTGTGTGGTAGG - Intergenic
1033761351 7:144439672-144439694 GGGTGTGAAAGGTGTGAGGATGG + Intergenic
1033796710 7:144853906-144853928 CAGAGTGAGTAGTGTGTGGAAGG - Intergenic
1034406913 7:150910473-150910495 GTGTGTGTATGGTGTGTGTGTGG + Intergenic
1034418298 7:150976578-150976600 CTCAGTGAAGGGTGTGTGGTGGG - Intronic
1034806442 7:154093598-154093620 GTGTGTGTATGGTGTGTGTGTGG - Intronic
1034910622 7:154995310-154995332 CAGCGTGTATGCTGTGTGGATGG - Intronic
1034937331 7:155208611-155208633 GTGTGGGAATTGTGTGGGGATGG + Intergenic
1035388423 7:158489723-158489745 CTGTGTGAACGGTGAGTGTGGGG - Exonic
1036005056 8:4652779-4652801 TTCTGTGAAGGGTGTGGGGATGG + Intronic
1036397882 8:8384305-8384327 CTGTGCAAAGGGAGTGTGGAAGG + Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1038682470 8:29681795-29681817 CACTGGGAATAGTGTGTGGATGG - Intergenic
1038697692 8:29820593-29820615 ATGTGTGTGTGGTGTGTGTATGG - Intergenic
1039343347 8:36675081-36675103 CTGTGTGTTTGGTGTGTGGGGGG + Intergenic
1039610896 8:38918503-38918525 ATGTGTGTATGGTGTGTGTCTGG - Intronic
1040109385 8:43560117-43560139 TTGTGTGAATGGTGAGTGGATGG - Intergenic
1040370913 8:46772730-46772752 TTTTGTGTATGGTGTGAGGAAGG + Intergenic
1042794233 8:72643131-72643153 GTGTGGAAAGGGTGTGTGGAAGG - Intronic
1044719269 8:95130094-95130116 CTGTGTGGCTCCTGTGTGGAGGG + Intergenic
1045946834 8:107805813-107805835 CAGTGACAATGGTGTGTGGCAGG + Intergenic
1046378281 8:113416926-113416948 CTGTATGAATACTGTGAGGAAGG + Intronic
1048196747 8:132337702-132337724 CTGTAGCAATGGTGTGTGCATGG - Intronic
1048293064 8:133195188-133195210 GTGTGTGTGTGGTGTGTGTATGG + Intronic
1048389506 8:133948152-133948174 CTGTGTGTATGGGGTGGGGGTGG + Intergenic
1048979822 8:139697247-139697269 ATGGGTGAATGGTGGATGGATGG + Intronic
1048989296 8:139751957-139751979 ATGTGTGAATGGTGGATGGGTGG - Intronic
1048989424 8:139752584-139752606 ATGTGTGAATGGTGGATGGGTGG - Intronic
1049028384 8:140013448-140013470 CAGTGTGAACGATGTGTGGCAGG - Intronic
1049308309 8:141919862-141919884 CCATGTGAGTGATGTGTGGAGGG + Intergenic
1052443132 9:28524242-28524264 TTGTGTGTATGGTGTGAGGTAGG - Intronic
1053273230 9:36764577-36764599 GTGCGTGAATGGTGTGTGAGTGG + Intergenic
1056493338 9:87130113-87130135 CTTTGTATATGGTGTGAGGAAGG + Intergenic
1056577868 9:87869670-87869692 CTGTGTGTGTGGTGTGTGTGTGG - Intergenic
1056806126 9:89730353-89730375 ATGTGTGTATGGTGTGTGTCTGG + Intergenic
1056950683 9:91038626-91038648 GTGTGTGCATGGTGTGTGAGTGG + Intergenic
1056950687 9:91038694-91038716 TTGTGTGCATGGTGTGTGAGTGG + Intergenic
1057022536 9:91710852-91710874 ATGTGTGGGTGGTGTGTGTAGGG + Intronic
1057545937 9:96020757-96020779 CTGTGGGGATGGGGAGTGGACGG + Intergenic
1057726358 9:97571283-97571305 CTGGGGGGATAGTGTGTGGAGGG - Intronic
1057894069 9:98892448-98892470 ATGTGTGAGTGGTGTGAGGTAGG + Intergenic
1059242215 9:112816255-112816277 CTGTGCGGGTGGTGTGGGGATGG + Intronic
1059248089 9:112865228-112865250 GTGTGTGTATGGTGTGTGTGGGG - Intronic
1059248092 9:112865239-112865261 ATGTGTGTGTGGTGTGTGTATGG - Intronic
1059624391 9:116046077-116046099 TTTTGTGTATGGTGTGAGGAAGG + Intergenic
1060025499 9:120167459-120167481 GTGTGTGTCTGGTGTGTAGAAGG + Intergenic
1060400607 9:123346898-123346920 CTGTGTGTATGGTGTGTATGTGG + Intergenic
1060661984 9:125409648-125409670 CTGTGTGTGTGGTGTGTGTCTGG - Intergenic
1060820950 9:126661425-126661447 CTCTGGGTATGGTGGGTGGAGGG + Intronic
1061256519 9:129456734-129456756 GTGGGTGAATGGAGGGTGGATGG + Intergenic
1061290464 9:129647872-129647894 GTGTGTGTGTGGTGTGTGGGTGG - Intergenic
1061396210 9:130344861-130344883 TTGTGTGTGTGGTGTGTGTATGG + Intronic
1061396221 9:130345017-130345039 GTGTGTGTGTGGTGTGTGCATGG + Intronic
1061616473 9:131783263-131783285 TTTTGTGTATGGTGTGAGGAAGG + Intergenic
1061741797 9:132712118-132712140 CTTTCTGTATGGTGTGAGGATGG - Intergenic
1062108546 9:134768957-134768979 CTGTGTCTAAGCTGTGTGGAGGG + Intronic
1062118983 9:134823864-134823886 GTGTGTGCATGATGTGTGTATGG + Intronic
1062433351 9:136535552-136535574 ATGGGTGCATGGTGGGTGGAGGG + Intronic
1062563604 9:137152941-137152963 ATGTGTGTATGGTGTATGCATGG - Intronic
1062628919 9:137454971-137454993 CTGTGTGATTGGAGTGGGGGAGG + Intronic
1185581100 X:1211995-1212017 CTGGGTGGATGGTGGATGGATGG + Intronic
1185648694 X:1633070-1633092 ATGAGTCCATGGTGTGTGGAGGG + Intronic
1186367263 X:8908853-8908875 ATGTGTGCATGGTGGGTGCAGGG + Intergenic
1188292314 X:28405012-28405034 CTGTGAGAATGGGGAGTGGTAGG - Intergenic
1189232499 X:39463535-39463557 CTGTGGGAAGGGTGGATGGATGG + Intergenic
1189344167 X:40228008-40228030 CTGGGTGCATGGTGAGTGGCAGG + Intergenic
1189492773 X:41482785-41482807 CTGGGTGATGGGTGTGGGGATGG + Intergenic
1190238933 X:48641629-48641651 GTGTGTGAGTGGTGAGTGAATGG + Intergenic
1190886047 X:54531513-54531535 CTGCATGGGTGGTGTGTGGAGGG - Intronic
1193595602 X:83440734-83440756 CTTTGTGTATGGTGTAAGGAAGG + Intergenic
1194974379 X:100378916-100378938 CTGTGTGAATGGTACGTGAGAGG - Intronic
1196041560 X:111210405-111210427 CTGTATGAATAGTGTATGTAAGG - Intronic
1196195751 X:112837530-112837552 TTGTGTGTGTTGTGTGTGGAAGG + Intronic
1196814485 X:119654125-119654147 ATGTGTGCAGGGTGTGCGGAGGG - Intronic
1197325133 X:125083513-125083535 GTGTGTGTATGATGTGTGTAAGG - Intergenic
1197762238 X:130036119-130036141 CTGGGTGAATGAGGTGAGGAGGG - Intronic
1199000345 X:142628995-142629017 TTTTGTGTATGGTGTGAGGAAGG + Intergenic
1199406156 X:147463164-147463186 CTGAGTGGAGGGTGTTTGGATGG - Intergenic
1200044018 X:153390825-153390847 GTGTGTGCATGGTGTGTGTGTGG - Intergenic
1200229845 X:154438401-154438423 CAGTGGGGATGGTGGGTGGAAGG + Intronic
1201229757 Y:11852773-11852795 CTGTGGGAATGGACTGTTGAAGG - Intergenic
1201253373 Y:12083473-12083495 TTTTGTGTATGGTGTATGGAAGG - Intergenic