ID: 963527957 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:146437925-146437947 |
| Sequence | CATTTAATGCAGTGGGTAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 10236 | |||
| Summary | {0: 1, 1: 29, 2: 2039, 3: 6169, 4: 1998} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 963527957_963527963 | 19 | Left | 963527957 | 3:146437925-146437947 | CCCTCTACCCACTGCATTAAATG | 0: 1 1: 29 2: 2039 3: 6169 4: 1998 |
||
| Right | 963527963 | 3:146437967-146437989 | TGTTTTGTCTTTGTTCTCATTGG | 0: 83 1: 2713 2: 4831 3: 3209 4: 2228 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 963527957 | Original CRISPR | CATTTAATGCAGTGGGTAGA GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||