ID: 963527957

View in Genome Browser
Species Human (GRCh38)
Location 3:146437925-146437947
Sequence CATTTAATGCAGTGGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10236
Summary {0: 1, 1: 29, 2: 2039, 3: 6169, 4: 1998}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963527957_963527963 19 Left 963527957 3:146437925-146437947 CCCTCTACCCACTGCATTAAATG 0: 1
1: 29
2: 2039
3: 6169
4: 1998
Right 963527963 3:146437967-146437989 TGTTTTGTCTTTGTTCTCATTGG 0: 83
1: 2713
2: 4831
3: 3209
4: 2228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963527957 Original CRISPR CATTTAATGCAGTGGGTAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr