ID: 963533667

View in Genome Browser
Species Human (GRCh38)
Location 3:146501734-146501756
Sequence CCATCTTGGAAGTAGAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963533667_963533674 6 Left 963533667 3:146501734-146501756 CCTGGTCTCTACTTCCAAGATGG No data
Right 963533674 3:146501763-146501785 GAACCCTGCATAATCTGGAGGGG No data
963533667_963533672 4 Left 963533667 3:146501734-146501756 CCTGGTCTCTACTTCCAAGATGG No data
Right 963533672 3:146501761-146501783 TTGAACCCTGCATAATCTGGAGG No data
963533667_963533673 5 Left 963533667 3:146501734-146501756 CCTGGTCTCTACTTCCAAGATGG No data
Right 963533673 3:146501762-146501784 TGAACCCTGCATAATCTGGAGGG No data
963533667_963533678 26 Left 963533667 3:146501734-146501756 CCTGGTCTCTACTTCCAAGATGG No data
Right 963533678 3:146501783-146501805 GGGAGGAATGCTGAAAGAACAGG No data
963533667_963533676 9 Left 963533667 3:146501734-146501756 CCTGGTCTCTACTTCCAAGATGG No data
Right 963533676 3:146501766-146501788 CCCTGCATAATCTGGAGGGGAGG No data
963533667_963533670 1 Left 963533667 3:146501734-146501756 CCTGGTCTCTACTTCCAAGATGG No data
Right 963533670 3:146501758-146501780 GCCTTGAACCCTGCATAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963533667 Original CRISPR CCATCTTGGAAGTAGAGACC AGG (reversed) Intergenic
No off target data available for this crispr