ID: 963535675

View in Genome Browser
Species Human (GRCh38)
Location 3:146525118-146525140
Sequence GATGCAGGCCACTGCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963535675_963535681 5 Left 963535675 3:146525118-146525140 CCCACACTGCAGTGGCCTGCATC 0: 1
1: 1
2: 0
3: 13
4: 175
Right 963535681 3:146525146-146525168 TCGTATACAAAGGTTTTATAGGG 0: 1
1: 0
2: 0
3: 8
4: 78
963535675_963535678 -5 Left 963535675 3:146525118-146525140 CCCACACTGCAGTGGCCTGCATC 0: 1
1: 1
2: 0
3: 13
4: 175
Right 963535678 3:146525136-146525158 GCATCTGACCTCGTATACAAAGG 0: 1
1: 0
2: 0
3: 5
4: 44
963535675_963535680 4 Left 963535675 3:146525118-146525140 CCCACACTGCAGTGGCCTGCATC 0: 1
1: 1
2: 0
3: 13
4: 175
Right 963535680 3:146525145-146525167 CTCGTATACAAAGGTTTTATAGG 0: 1
1: 0
2: 0
3: 1
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963535675 Original CRISPR GATGCAGGCCACTGCAGTGT GGG (reversed) Intronic
901145380 1:7061414-7061436 GATGCAGGCCAGCGCAGCATGGG - Intronic
901914831 1:12490615-12490637 GATGCAGCCCACAGCATGGTGGG + Intronic
901914861 1:12490779-12490801 GATGCAGCCCACGGCATGGTGGG + Intronic
901914877 1:12490861-12490883 GATGCAGCCCACGGCATGGTGGG + Intronic
902424221 1:16306740-16306762 CATGCATGCCACTGCAGCCTGGG - Intronic
903215482 1:21841337-21841359 GCTGGAGGCCATGGCAGTGTGGG - Intronic
904528435 1:31152364-31152386 GAAGAAGGCCACTGCAGTACAGG - Intergenic
906028106 1:42692699-42692721 GAGGCAGGCCACTGCAGGCCTGG + Intronic
906414255 1:45607772-45607794 AAAGCAGGGCACTGCAGTGGAGG + Exonic
906782764 1:48586999-48587021 GATACAGGCTTCTTCAGTGTAGG + Exonic
911647412 1:100351885-100351907 GATGCAGACCCCCTCAGTGTTGG + Intronic
912541047 1:110415798-110415820 GATGCAGGCCTGTGCACTGAGGG + Intergenic
914384064 1:147150531-147150553 GATGCAGTGCACTGCAGCCTGGG - Intergenic
915056198 1:153133543-153133565 GCTGCAGGCAACTGCAGTCATGG - Intergenic
915248673 1:154573070-154573092 GAAGAAGGGCACTGCGGTGTGGG + Intronic
916197598 1:162239361-162239383 GATGCAGTCCACTGAATTTTAGG - Intronic
916857449 1:168764959-168764981 GACTCAGGGCCCTGCAGTGTTGG - Intergenic
918047807 1:180952049-180952071 GAGGCAGTCCTGTGCAGTGTTGG + Intergenic
919669297 1:200324316-200324338 CTTGCAGGCCACTGCAATGAGGG - Intergenic
921728283 1:218548661-218548683 TTTTCAGGCCACTGCCGTGTGGG + Intergenic
922083905 1:222326503-222326525 GAGGTAGGGCAATGCAGTGTAGG + Intergenic
922906935 1:229180618-229180640 GCTGCTGCTCACTGCAGTGTGGG - Intergenic
1063514957 10:6686891-6686913 GATGCAGAATGCTGCAGTGTTGG - Intergenic
1069472922 10:68708913-68708935 GATGGAGTCTAGTGCAGTGTTGG - Intergenic
1070856201 10:79609944-79609966 GAGTCAGGCCAGTGCAGGGTGGG - Intergenic
1071380574 10:85055344-85055366 GATTCAGGCTACTCTAGTGTAGG - Intergenic
1072308680 10:94133278-94133300 GATGAAAGCCAATGGAGTGTGGG + Intronic
1072339611 10:94434151-94434173 GATGATGCCCAATGCAGTGTAGG + Intronic
1073814593 10:107192566-107192588 GATGCAGGCTTCTGCAGGCTGGG + Intergenic
1074833326 10:117265024-117265046 GCTGCAGGCCACTGCTGTGCTGG + Intronic
1075614601 10:123882344-123882366 GACACAGGCCAAAGCAGTGTCGG - Intronic
1075668450 10:124246999-124247021 GCTGCTGGCCCCTGCAGTGGAGG - Intergenic
1077247706 11:1547440-1547462 GCTGCAGGCCAGTGTAGGGTGGG - Intergenic
1077272008 11:1685785-1685807 GAAGGAGGCCCCTGGAGTGTGGG - Intergenic
1077981778 11:7308335-7308357 GAGGTGGGCCACTGCAGTGAAGG + Intronic
1079268390 11:18957982-18958004 GAAGCAGGTAACTGAAGTGTGGG + Intergenic
1079867648 11:25756393-25756415 GCGGGAGGCCACTGCAGTGGGGG - Intergenic
1080144433 11:28963898-28963920 GAGGCAGGACATTGCAGTTTTGG - Intergenic
1083202800 11:61130680-61130702 TATGCAGCCCCCTGCACTGTGGG - Exonic
1084172028 11:67405445-67405467 GATGCTGGCCCCTGTTGTGTGGG + Exonic
1089601419 11:119617641-119617663 GCTGCTGGCCGCTCCAGTGTGGG + Intergenic
1096293618 12:50364121-50364143 GATACTGTCCACTGCACTGTAGG - Intronic
1098073667 12:66703019-66703041 CATGTAAGTCACTGCAGTGTTGG + Intronic
1099385527 12:82008396-82008418 GATGCAGGCCACTGGAATTCTGG + Intergenic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1103960301 12:124605339-124605361 GTTGCAGGCCCCTGCAGGGAGGG - Intergenic
1106421806 13:29591531-29591553 TGTGCAGGACACGGCAGTGTGGG + Intronic
1106480431 13:30133363-30133385 GAGGCAGGCCACAGCGCTGTGGG + Intergenic
1113587417 13:111474856-111474878 GCAGGAGGCCACTGCAGTGCAGG + Intergenic
1115170399 14:30498433-30498455 GAAGGAAGCCACTACAGTGTAGG + Intergenic
1117512855 14:56471070-56471092 GGTGCAGGCAATTGCAGTGGTGG + Intergenic
1120880077 14:89408839-89408861 GTTGAAGGCAACTTCAGTGTGGG + Intronic
1124982750 15:34580833-34580855 CAGGCAGGCCTCTGCAGTGTAGG - Intronic
1126791197 15:52222710-52222732 GGTGATGGCCACAGCAGTGTGGG + Intronic
1127517532 15:59710656-59710678 AATGGAGGCCAGTGCAGTGGTGG + Intergenic
1128559217 15:68653552-68653574 GATGCAGCCCCTTTCAGTGTGGG - Intronic
1133103422 16:3492661-3492683 AATGCAGGCCATGGCATTGTGGG - Intergenic
1133891781 16:9886018-9886040 CAAGGAGGCCACTGCAGTGCAGG - Intronic
1134049822 16:11129739-11129761 GAACCAGGCCAATGCAGTGGCGG - Intronic
1134662069 16:15991771-15991793 GTTCAAGGCCACTGCAGAGTCGG - Intronic
1136555815 16:31007309-31007331 GATTCAGGCTCCTGCAGTGCAGG + Intronic
1139440757 16:66965486-66965508 GATGGTGGCCAAGGCAGTGTGGG + Intronic
1142529091 17:566590-566612 GATGGAGGCCGGTGCAGTGGAGG + Intronic
1144467827 17:15510573-15510595 CATACAGGCCATTGCAGAGTTGG - Intronic
1147323505 17:39659484-39659506 GAAGGAGGCCACGGCAGTGGTGG + Exonic
1151799578 17:76370064-76370086 GCTTCAGGCCACTGCACTTTAGG + Intronic
1153905767 18:9659861-9659883 GGTGCAGTGCACTGGAGTGTGGG - Intergenic
1157731442 18:50007657-50007679 GCTTCAGGCCACTGCAACGTGGG - Intronic
1158098290 18:53800405-53800427 GATGGAGGCCACTGGAGAGATGG + Intergenic
1160190885 18:76713262-76713284 GGTGCAGGTCACTGCAGTCTGGG + Intergenic
1160520351 18:79504812-79504834 GAGGCAGGAGACTGCTGTGTGGG + Intronic
1160520381 18:79504926-79504948 GAGGCAGGAGACTGCTGTGTGGG + Intronic
1160520452 18:79505211-79505233 GAGGCAGGAGACTGCTGTGTGGG + Intronic
1160520519 18:79505496-79505518 GAGGCAGGAGACTGCTGTGTGGG + Intronic
1160520534 18:79505553-79505575 GAGGCAGGAGACTGCTGTGTGGG + Intronic
1160520560 18:79505667-79505689 GAGGCAGGAGACTGCTGTGTGGG + Intronic
1160520575 18:79505724-79505746 GAGGCAGGAGACTGCTGTGTGGG + Intronic
1160520589 18:79505781-79505803 GAGGCAGGAGACTGCTGTGTGGG + Intronic
1160700226 19:502791-502813 GATGCAGGACACAGCAGTAAGGG - Intronic
1162333011 19:10041922-10041944 GATGCAGGTGAGTCCAGTGTGGG - Intergenic
1162393104 19:10401619-10401641 CAAGCAAGCCACTGGAGTGTGGG - Intronic
1163815509 19:19462455-19462477 GAGGCAGGCCACTGCGGGGCGGG - Intronic
1165248512 19:34512419-34512441 GATCCAGGCAGCTGCAGTGCAGG + Intergenic
1168524620 19:57078981-57079003 TATGGAAACCACTGCAGTGTGGG - Intergenic
925765014 2:7224538-7224560 GAAGCAGGTCACTGAAGTCTTGG + Intergenic
928067113 2:28175657-28175679 GATGATGGCCACGGCAGTGGTGG - Intronic
931824032 2:65980830-65980852 GATGCAGGCCACTGAAAGGATGG + Intergenic
932308259 2:70719188-70719210 GCTGCCAGTCACTGCAGTGTGGG + Intronic
932459525 2:71873287-71873309 GATGCCTTCCCCTGCAGTGTGGG + Intergenic
935660587 2:105463575-105463597 TATCCAGGGCACTGCAGTTTGGG - Intergenic
939075844 2:137602007-137602029 GGAGCAGGCCACTGCAGTTTTGG - Intronic
945538143 2:211046369-211046391 GATGCAAGCCAATTCTGTGTGGG + Intergenic
946161944 2:217840795-217840817 GATGCAGGCCTTTGCAATGAGGG - Intronic
948116231 2:235495538-235495560 GTTGGAGGCCACTGAAGTGGAGG + Intronic
948314306 2:237015492-237015514 GAGGCTGGGCTCTGCAGTGTGGG + Intergenic
948416849 2:237813609-237813631 GATGCAGGCCACTGCAGTGGTGG + Exonic
1169389070 20:5174797-5174819 TATTCAGGGCAGTGCAGTGTAGG + Intronic
1169910244 20:10642256-10642278 GCTGCAAGCCACAGCAGTTTGGG + Intronic
1175777915 20:61664482-61664504 GATGCAGGCTGCTGCATTTTCGG - Intronic
1175811474 20:61860726-61860748 CATCCAGGCCCCTGCAGGGTTGG + Intronic
1175974120 20:62701869-62701891 GGTGCAGGGCACTACAGTGCAGG + Intergenic
1178605691 21:34034830-34034852 GCTGCATGCCTCTGCCGTGTGGG + Intergenic
1183095504 22:35549613-35549635 GATGGAGGGAACTGCAGTGTGGG - Intronic
1184883999 22:47330990-47331012 GATGGTGGCCACTGAAGTGAAGG + Intergenic
952308457 3:32166483-32166505 AATGCAGACAACTGCAGTGAGGG - Exonic
962938224 3:140101238-140101260 TATGCAGTCCACTGGAGGGTAGG - Intronic
962988044 3:140553666-140553688 GCTGCAAGCCACTGAAGTGGAGG + Intronic
963535675 3:146525118-146525140 GATGCAGGCCACTGCAGTGTGGG - Intronic
964656804 3:159076156-159076178 GATGTATGTCTCTGCAGTGTGGG + Intronic
966201023 3:177359694-177359716 GAGGAAGGCCCCTGCAGGGTGGG + Intergenic
966599030 3:181756796-181756818 GGTGCAGGGCACTGCAATTTAGG - Intergenic
968075787 3:195815554-195815576 GCTGCTGGCCCCTGCAGGGTGGG + Intergenic
968612290 4:1562797-1562819 GCTGCTGGACACGGCAGTGTGGG + Intergenic
968886206 4:3334840-3334862 GATGCGGGTCACTGATGTGTTGG + Intronic
969238859 4:5887020-5887042 GATGCAGGACAGTGCAGGGGAGG + Intronic
969342171 4:6549140-6549162 TTTGGAGGCTACTGCAGTGTAGG - Intronic
969630063 4:8330703-8330725 GATGGAGGCCACTGTGGTCTCGG - Intergenic
970686486 4:18573388-18573410 AATTCTGGCCAATGCAGTGTGGG + Intergenic
972913293 4:43846277-43846299 GCTGCTGGCCCCTGCAGTGAGGG + Intergenic
973158689 4:46990789-46990811 CATGAAGGCAAATGCAGTGTAGG + Intronic
974074571 4:57157016-57157038 AATCTAGGCCATTGCAGTGTAGG + Intergenic
978250866 4:106630164-106630186 GATGCAATCCACTCCAGTGTTGG + Intergenic
978326588 4:107564327-107564349 GATGCAATCCTCTGAAGTGTGGG + Intergenic
978630905 4:110742981-110743003 CATGCAGTCCATAGCAGTGTCGG + Intergenic
982581726 4:157187751-157187773 GATGCAGTCCACTGTGGTCTGGG - Intergenic
984735641 4:183105341-183105363 AATGCAGGGCCCGGCAGTGTGGG - Intronic
985052182 4:186001886-186001908 CTTTCAGGCCACTGCAGTGGTGG - Intergenic
985468879 5:24692-24714 GACACTGGCCCCTGCAGTGTGGG - Intergenic
985549764 5:527034-527056 GATGGTGGCCCCTGCAGTGGTGG - Intergenic
985733521 5:1564520-1564542 TCTGGAGGCCCCTGCAGTGTGGG + Intergenic
985779189 5:1861058-1861080 GCTGCTGGCCTCTGCAGGGTGGG - Intergenic
985948244 5:3202996-3203018 GATGCAGGCCACATCAGCGTTGG + Intergenic
985958477 5:3281976-3281998 GATGAAGGCCACTGTACTGTCGG - Intergenic
985998784 5:3613806-3613828 TCTGCATGCCACGGCAGTGTGGG - Intergenic
986173563 5:5333028-5333050 GTTGGAGGCCCCTGCAGGGTTGG - Intergenic
986504101 5:8430653-8430675 CATGCAGGCCACTGCTGGGAGGG - Intergenic
986540110 5:8836048-8836070 GCTGCACTCCAATGCAGTGTGGG - Intergenic
991386264 5:66093614-66093636 TTTGCAGGCCAGAGCAGTGTGGG + Intergenic
992100113 5:73399009-73399031 CATGCACACCACTGCAGGGTAGG + Intergenic
994593269 5:101799281-101799303 GATGAAGGCTACTGCAATCTTGG - Intergenic
995794294 5:115925403-115925425 GTTATTGGCCACTGCAGTGTTGG + Intergenic
996004679 5:118405833-118405855 GCTGCAGGCAGCTGCAGTGATGG + Intergenic
999882212 5:155878257-155878279 GATTCAAGCCACTGAACTGTTGG - Intronic
1000911318 5:167026200-167026222 GATTTTGCCCACTGCAGTGTTGG + Intergenic
1001617606 5:173056143-173056165 GGTGCCGGCCTCTGCAGTGTGGG - Intergenic
1003219391 6:4144913-4144935 ATTGCAGGCCACAGCAGTGAGGG - Intergenic
1008041533 6:46806543-46806565 GTTGCTGCCCACTGCAGTGGAGG - Intronic
1013020956 6:106217586-106217608 CATTCAGGTCACAGCAGTGTGGG - Intronic
1013829331 6:114254145-114254167 GATGAAGCGCACTGCAGTGGTGG + Intronic
1016782259 6:147972326-147972348 CAAGCAGGCCAGTGCAGTCTGGG + Intergenic
1019168706 6:170116680-170116702 AATGCTGGTCACAGCAGTGTTGG + Intergenic
1019804910 7:3116730-3116752 GCTGCAGGCCACTGCAGAATGGG - Intergenic
1020220776 7:6234971-6234993 GATGCAAGGCACTGAAGTGAGGG - Intronic
1023033417 7:36109999-36110021 GTTGCAGGACAATGAAGTGTTGG - Intergenic
1024301397 7:47890116-47890138 GATGGAGGGGACAGCAGTGTGGG - Intronic
1024621488 7:51161432-51161454 GATGGAAGCCTCTGCAGTATTGG - Intronic
1025056830 7:55771993-55772015 GATGCAGGAGAGTGCAGTGAGGG + Intergenic
1025294069 7:57761782-57761804 GAGACAGGCCACTGAAATGTGGG - Intergenic
1026782630 7:73280077-73280099 GATGCAGGCCACTTCTGCCTTGG + Intergenic
1027023394 7:74832902-74832924 GATGCAGGCCACTTCTGCCTTGG + Exonic
1027064537 7:75112416-75112438 GATGCAGGCCACTTCTGCCTTGG - Exonic
1028290370 7:89057710-89057732 GAAGCAGGCCACTGTGGAGTGGG + Intronic
1029571290 7:101371295-101371317 ATTGCATGCCTCTGCAGTGTTGG + Intronic
1034470250 7:151251072-151251094 GATGCTGGGCACTCCAGTTTGGG + Intronic
1034480942 7:151320316-151320338 CATGCTGGCCACTGCAGGGAGGG + Intergenic
1034877939 7:154741868-154741890 GATGCAGGACACTGGGATGTGGG - Intronic
1035127089 7:156616579-156616601 GCTGCAGGCCTCTGCGGTGACGG + Intergenic
1035301824 7:157902308-157902330 TCTCCAGGCCACTGCAGGGTTGG - Intronic
1035662104 8:1356025-1356047 GATCGGGGCCACTGCACTGTCGG + Intergenic
1040677107 8:49763752-49763774 GGAACAGGCCACTGCAATGTTGG - Intergenic
1041031679 8:53742722-53742744 GATGCAGGCACATACAGTGTAGG - Intronic
1041446560 8:57957736-57957758 GATGCAGCCCGCTTCAGTGTGGG + Intergenic
1041716722 8:60939182-60939204 AAAGCAGGGCACTGCAGTGGAGG - Intergenic
1042132969 8:65607217-65607239 AATGCAGGCCCCTGCAGAGCAGG - Intronic
1043287635 8:78554005-78554027 GACCCATGACACTGCAGTGTTGG + Intronic
1049071510 8:140359103-140359125 TCTGCAGGCCACGGCAGTGCAGG + Intronic
1055499199 9:76886461-76886483 TATGCAGGTTACTGCTGTGTGGG - Intronic
1055626715 9:78183025-78183047 GATGCCTGGCACTGCAGTTTAGG - Intergenic
1060888855 9:127175627-127175649 GTTCTAGGCCACTGCAGTCTTGG + Intronic
1062480640 9:136749274-136749296 GGTGCAGGCCACGGCACTGGGGG - Intergenic
1185746161 X:2575206-2575228 GAGGAAGGCAACTGCAATGTTGG - Intergenic
1186029018 X:5346747-5346769 GATGAAGGCCAATGGGGTGTAGG - Intergenic
1187403516 X:18983450-18983472 TACGCAGGACTCTGCAGTGTGGG - Intronic
1190418195 X:50201637-50201659 TATTCAGGCCACTGCAGTAGAGG + Intergenic
1191627150 X:63281692-63281714 GATTTAGGCCACAGCAGTTTTGG - Intergenic
1192437730 X:71153264-71153286 GTTGCAGGCCCCTGCTGTGCTGG - Intronic
1198548526 X:137719762-137719784 CATGCAGGCACCTGCAGTGGTGG + Intergenic
1201583884 Y:15539223-15539245 GATACAAGCAACTGCAGTTTGGG - Intergenic
1201641045 Y:16177351-16177373 GATGAAGGCCAATGGAGTGTAGG + Intergenic
1201661770 Y:16407975-16407997 GATGAAGGCCAATGGAGTGTAGG - Intergenic