ID: 963538574

View in Genome Browser
Species Human (GRCh38)
Location 3:146559217-146559239
Sequence TACCTTCCTGAATATGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963538572_963538574 1 Left 963538572 3:146559193-146559215 CCATTAAAAACCTTTGTCTTTCT 0: 6
1: 52
2: 102
3: 195
4: 936
Right 963538574 3:146559217-146559239 TACCTTCCTGAATATGAGCATGG No data
963538573_963538574 -9 Left 963538573 3:146559203-146559225 CCTTTGTCTTTCTTTACCTTCCT No data
Right 963538574 3:146559217-146559239 TACCTTCCTGAATATGAGCATGG No data
963538571_963538574 14 Left 963538571 3:146559180-146559202 CCTCACTTTTTTTCCATTAAAAA No data
Right 963538574 3:146559217-146559239 TACCTTCCTGAATATGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963538574 Original CRISPR TACCTTCCTGAATATGAGCA TGG Intergenic
No off target data available for this crispr