ID: 963538800

View in Genome Browser
Species Human (GRCh38)
Location 3:146561449-146561471
Sequence AGCAAGGCATGTCCTTCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963538791_963538800 16 Left 963538791 3:146561410-146561432 CCTCAGGAAACTTACAACCATGG 0: 134
1: 5838
2: 8315
3: 6752
4: 4301
Right 963538800 3:146561449-146561471 AGCAAGGCATGTCCTTCACAAGG No data
963538798_963538800 -1 Left 963538798 3:146561427-146561449 CCATGGTGGAAGGTAAAGGGGAA No data
Right 963538800 3:146561449-146561471 AGCAAGGCATGTCCTTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963538800 Original CRISPR AGCAAGGCATGTCCTTCACA AGG Intergenic
No off target data available for this crispr