ID: 963538911

View in Genome Browser
Species Human (GRCh38)
Location 3:146562239-146562261
Sequence ACTAGGCAGTGCCCCAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963538904_963538911 -5 Left 963538904 3:146562221-146562243 CCCTCTTTTCACAGCTCCACTAG No data
Right 963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG No data
963538905_963538911 -6 Left 963538905 3:146562222-146562244 CCTCTTTTCACAGCTCCACTAGG No data
Right 963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG No data
963538902_963538911 21 Left 963538902 3:146562195-146562217 CCATTCTGGGTTCTGGAGGACAG No data
Right 963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963538911 Original CRISPR ACTAGGCAGTGCCCCAGTGG GGG Intergenic