ID: 963538911

View in Genome Browser
Species Human (GRCh38)
Location 3:146562239-146562261
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 15, 1: 42, 2: 72, 3: 90, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963538905_963538911 -6 Left 963538905 3:146562222-146562244 CCTCTTTTCACAGCTCCACTAGG 0: 87
1: 1704
2: 2054
3: 1450
4: 907
Right 963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG 0: 15
1: 42
2: 72
3: 90
4: 211
963538902_963538911 21 Left 963538902 3:146562195-146562217 CCATTCTGGGTTCTGGAGGACAG 0: 20
1: 527
2: 905
3: 1706
4: 1828
Right 963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG 0: 15
1: 42
2: 72
3: 90
4: 211
963538904_963538911 -5 Left 963538904 3:146562221-146562243 CCCTCTTTTCACAGCTCCACTAG 0: 84
1: 1771
2: 2057
3: 1358
4: 957
Right 963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG 0: 15
1: 42
2: 72
3: 90
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900523321 1:3116542-3116564 ACCAGGCACTGCCCCAGCCGGGG - Intronic
902540730 1:17152652-17152674 ACTAGGCTGTGCCCCAGTTAGGG - Intergenic
902699799 1:18164025-18164047 ACTGGGCAGTCTCCCATTGGTGG - Intronic
902967027 1:20012742-20012764 ACTGGGCATTGCCTTAGTGGAGG + Intergenic
903545512 1:24121267-24121289 ACTAGAAAGTGTCCCAGTGGGGG + Exonic
905020569 1:34808172-34808194 ACTAAGCATTGCCCAAGTGGGGG + Intronic
905824625 1:41018735-41018757 ACTAGGAAGTGGCCCCGAGGAGG - Intronic
906476232 1:46171422-46171444 ACTGGGCAGAGAGCCAGTGGAGG + Intronic
906589106 1:47006990-47007012 GCTATGCCCTGCCCCAGTGGTGG - Intergenic
909099377 1:71331982-71332004 ACTAGGCATTGCCCTAGTGGAGG + Intergenic
909405305 1:75281954-75281976 ACTAGGCAATGCCCCAGTGGAGG - Intronic
910512422 1:88021916-88021938 ACTTGGCACTGCCCTAGTAGAGG + Intergenic
912068687 1:105779801-105779823 ACCAGGCAGTGCCCCAGTGAGGG - Intergenic
912084054 1:105977084-105977106 ACCAAGCAGTGCCCCAGTGTGGG - Intergenic
912107868 1:106303617-106303639 GCTAGGCATTGCCCTAGTTGGGG + Intergenic
912778761 1:112524627-112524649 AGCAGGCAGTTCCCAAGTGGAGG - Exonic
913254181 1:116939192-116939214 ACTAGGCCATGCCCCAGTAGGGG + Intronic
913316574 1:117558779-117558801 ACTAGGTGGTGCCCCAGTAGGGG + Intergenic
914417877 1:147501178-147501200 ACTAGTCTGTGCACCAGTGGAGG + Intergenic
915786993 1:158624222-158624244 ACTAGGCAGTACCCCAGTGAGGG - Intronic
916982556 1:170154322-170154344 ACTAGGCAGTGCCCCCAGTGGGG - Intronic
917152102 1:171956644-171956666 ACTAGGCAGTGCCCCAGTAAGGG + Intronic
917282046 1:173386605-173386627 ACTATGCATTACCCCAGTGGGGG - Intergenic
917408745 1:174736560-174736582 ACTAGGCAGTGCCCTGGTGGAGG + Intronic
919129215 1:193432816-193432838 ACTAGGCAGTGCCCCATGTGTGG + Intergenic
919161843 1:193840488-193840510 AGTAGGCATTGCCCTAGTAGGGG + Intergenic
919536715 1:198796832-198796854 ATTAGACAGTGCCCCAGTGGGGG + Intergenic
921220163 1:212967974-212967996 TCTAAGCAGTCCCCTAGTGGTGG - Intronic
921996554 1:221425839-221425861 ACTAGGCAGCACCCCAGTGGGGG + Intergenic
922709109 1:227813826-227813848 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
923179143 1:231499236-231499258 ACTAGGTAGTGCCCCAGTGGGGG + Intergenic
1062770465 10:96340-96362 ACTAGGCAGTGCCCCTGTGGGGG + Intergenic
1062868362 10:876722-876744 ACTAGGCAATGCCCTGGTGGGGG + Intronic
1066684248 10:37965279-37965301 ATTAGGCAGTACCCCAGTGGGGG - Intronic
1066975518 10:42364909-42364931 ACTATGCTATGCCCCAGTGAGGG + Intergenic
1067052243 10:43028404-43028426 ACTAGGCAGTGTCGCTGTGTCGG - Intergenic
1067162424 10:43838545-43838567 CCTGGGCATTGCCCGAGTGGAGG + Intergenic
1068065114 10:52120853-52120875 ACTAGGCATTGCCCTAGCAGTGG + Intronic
1068147772 10:53093166-53093188 ACTAGGCAGTGCTCCTGTGTAGG - Intergenic
1068399419 10:56509055-56509077 ACTAGACAGTGCCCCAGTGGTGG - Intergenic
1068604512 10:58990424-58990446 ACTAGACAGTGCCTCAGTGGGGG - Intergenic
1069106120 10:64385136-64385158 ACTAGGCAGTGCTCCAGTGGGGG + Intergenic
1069773489 10:70913791-70913813 AAATGCCAGTGCCCCAGTGGAGG + Intergenic
1070581639 10:77724909-77724931 ACTAGGCAGTGGCCCAGTGGGGG - Intergenic
1070637659 10:78142170-78142192 ACTAGGCACTGCCCCGGTGGGGG - Intergenic
1070667551 10:78356167-78356189 ACTATGGAGTGGGCCAGTGGTGG + Intergenic
1070808671 10:79286300-79286322 ACCAGGCATTCCCCCGGTGGTGG + Intronic
1073375644 10:103032016-103032038 ACTAGTCACTGCGGCAGTGGAGG + Intronic
1073751106 10:106527956-106527978 ACTAGGCATTGCATTAGTGGGGG - Intergenic
1074657991 10:115616951-115616973 ACTAGGCAGTGCCCCAGTGAGGG - Intronic
1074803945 10:117028897-117028919 ATCAGGCAGTGCCTCAGTGGGGG - Intronic
1075720049 10:124579227-124579249 ACTGGCCAGCGCCCCGGTGGTGG - Intronic
1075737008 10:124670220-124670242 CTTAGGCAGGGCCCCAGTGTCGG - Intronic
1076395871 10:130136855-130136877 ACTCAGCCGTGCCGCAGTGGCGG + Intronic
1077735151 11:4783065-4783087 ACTAGGTGGTGCCCCAGTAGGGG - Intronic
1078064987 11:8072339-8072361 CCTAGGCAGGGCAGCAGTGGTGG + Intronic
1079005979 11:16791256-16791278 GCTAGGTACTGCCACAGTGGAGG + Intronic
1080707108 11:34706863-34706885 ACTCAGCACAGCCCCAGTGGTGG - Intergenic
1082959065 11:58901805-58901827 ACCAAGCACTGCCCCACTGGAGG + Intronic
1083673656 11:64313920-64313942 AAGAGGCAGGGCTCCAGTGGCGG - Intronic
1084090885 11:66878850-66878872 GCTGGGCTGTGCCCCAGAGGAGG - Intronic
1085387651 11:76166266-76166288 ACTTGGCTGTGCCCCCGTGTTGG + Intergenic
1085593928 11:77791006-77791028 ACTAGGCAGTGCCCCAGGTAGGG + Intronic
1086056600 11:82654217-82654239 ACTAGGCAGTGCCCCAGTAAAGG - Intergenic
1086176795 11:83900772-83900794 ACTAGGTAGTGCCCCAAGGTGGG - Intronic
1087336621 11:96852038-96852060 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1087675656 11:101158410-101158432 ACCAGGCTGTGCTCCAGTGGGGG - Intergenic
1088708854 11:112488073-112488095 ACAAGACAGTGCCCCATTAGAGG + Intergenic
1089307434 11:117535475-117535497 ACTAGGCAGACCCCCACTCGGGG + Intronic
1090134009 11:124176865-124176887 ACTAGGCAGGGTCCCAGTGCAGG - Intergenic
1091314002 11:134597917-134597939 AACATGCAGTGCCCCACTGGAGG - Intergenic
1094815417 12:34178908-34178930 ACTAGGCCATGCCCCAGTGGGGG + Intergenic
1095216714 12:39557941-39557963 ACTAGGCAATGCCCCAGTGGGGG - Intronic
1095825901 12:46530728-46530750 GCTCGGCAGTCACCCAGTGGGGG - Intergenic
1096304669 12:50463798-50463820 ACTATGCAGTGCCCTAGTGGAGG + Intronic
1096459780 12:51815641-51815663 GGTAGGCAGGGCCCCAGTGTTGG - Intergenic
1097501520 12:60409819-60409841 CCTAGGCAATGCCCCAGTGGGGG + Intergenic
1097571238 12:61335000-61335022 ACTAGGCAATGCCCCAGTAAGGG + Intergenic
1097614447 12:61866704-61866726 ACTGGGCAGTGTCCAAGTGGTGG + Intronic
1098559082 12:71851939-71851961 ACTAGGCAGTGCTCTTGTGGAGG + Intronic
1099089892 12:78293035-78293057 ACTAGACAGTCCCAAAGTGGGGG - Intergenic
1099475584 12:83104280-83104302 ACTAGGCAGTGCCCCGTGGGGGG + Intronic
1099487789 12:83249566-83249588 ACTAGGCAGTTTCCCAGTTGGGG - Intergenic
1099635226 12:85204360-85204382 ACTAGGTGGTGCCCCAGTAGGGG - Intronic
1099658711 12:85527835-85527857 ACTAGACAATGCTCCAGTGAGGG - Intergenic
1099663465 12:85596439-85596461 ACTAGGTGGTACCCCAGTAGGGG + Intergenic
1099760320 12:86912548-86912570 ACTAGGCAGTGTCTCAGTGGGGG - Intergenic
1099890828 12:88586530-88586552 ACTAGGCAGTGACCTAGTAGGGG + Intergenic
1099984701 12:89649149-89649171 ACTAAGCAGTGCCCTAGTGGGGG - Intronic
1100318521 12:93467598-93467620 ACTGGGCAGTCCCACAGTGTTGG + Intronic
1100473058 12:94910902-94910924 TAAAGACAGTGCCCCAGTGGAGG + Intronic
1101052110 12:100874246-100874268 ACAAGGCAGTGCCCCAGTGAAGG - Intronic
1104439260 12:128781708-128781730 TCTGGGAAGTGCCCCATTGGCGG + Intergenic
1104742031 12:131184718-131184740 ACTAGGCAGTGCCCCAATGTGGG + Intergenic
1109819856 13:67638724-67638746 ACTAGGCATTACCCTAGTAGAGG - Intergenic
1110062663 13:71062337-71062359 ACTTAGCAGTGCCCCAGTGGGGG + Intergenic
1110912075 13:80977583-80977605 ACTGGGCAGTGAGCCTGTGGAGG + Intergenic
1111239690 13:85457871-85457893 ACTAGCCAGTGTCCCAGTGGGGG - Intergenic
1112251385 13:97783791-97783813 ACTAGGCATTGCCCTTTTGGGGG - Intergenic
1112336934 13:98523851-98523873 GCTGGGCACTGCCCCAGCGGAGG + Intronic
1113029359 13:105976561-105976583 AGTAGGCAGTGCCCCAATGCGGG + Intergenic
1113269314 13:108655534-108655556 ACTAGGCAGTGCCCCAGTGGAGG - Intronic
1114081360 14:19203765-19203787 ACTTGGCACTGCCCCAGGAGAGG - Intergenic
1114529858 14:23388912-23388934 ACTCGGAGGTGGCCCAGTGGAGG - Exonic
1114535217 14:23418263-23418285 ACTCGGAGGTGGCCCAGTGGAGG - Exonic
1115340769 14:32291185-32291207 ACTAGGCAGTGCCCCACAGTGGG - Intergenic
1116095327 14:40359848-40359870 ACTAGGCAATGCCCCAGTCTGGG - Intergenic
1116098875 14:40408260-40408282 ACTAGGCAGTGCCCCAGTGAGGG + Intergenic
1116287177 14:42988122-42988144 ACTAGGCAGTGTCCCAGTAGGGG - Intergenic
1116485543 14:45444197-45444219 ATTAGGCAGTGCCCCAGTGTGGG - Intergenic
1116756746 14:48957918-48957940 ACTAGGCATTGCTCTAGTAGGGG - Intergenic
1117559562 14:56922995-56923017 ACTAGGCATTGCTGTAGTGGGGG - Intergenic
1117846133 14:59913687-59913709 TCTGGGCATTGCCCTAGTGGGGG - Intergenic
1119560989 14:75589614-75589636 ACTAGGCATTACCCTTGTGGGGG + Intronic
1120292245 14:82590217-82590239 ACTAAGCATTGCCCTAGTAGGGG - Intergenic
1120735618 14:88048588-88048610 ACTAGGAAGTGACACAGAGGAGG - Intergenic
1121640246 14:95480505-95480527 ACCAGCCAGTCCCCCAGAGGTGG + Intergenic
1124464038 15:29920099-29920121 ACCTGGCAGTGCCCCAGTTTCGG - Intronic
1125136095 15:36345120-36345142 ACTAAGCATTGCCCTAGTGCAGG - Intergenic
1127576225 15:60295098-60295120 ACTAGGCAGTGCCCCAGCAGGGG + Intergenic
1128713395 15:69888903-69888925 ACTAGGTATTGCCCTAGTAGGGG - Intergenic
1129130327 15:73487820-73487842 ACTAGGCATTGCCCTGGTGGGGG + Intronic
1130977711 15:88789882-88789904 TCTAGTCAGTTTCCCAGTGGCGG - Intergenic
1131410234 15:92201288-92201310 ACTAGGTAGTGCCCTGGTGGGGG - Intergenic
1131453556 15:92565712-92565734 ACTAGGTAGTGCCCTGGCGGGGG + Intergenic
1131987566 15:98060503-98060525 ACTAGGCAGTGCCCCAGTAGAGG + Intergenic
1132261812 15:100432402-100432424 ACCAGACAATTCCCCAGTGGAGG + Intronic
1135955878 16:26955826-26955848 TCTTGGCAGTGCCTCAGAGGGGG + Intergenic
1137338066 16:47571316-47571338 TATATGCAGTACCCCAGTGGTGG + Intronic
1139489280 16:67278096-67278118 AGAAGGCAGTGACTCAGTGGGGG + Exonic
1139949824 16:70663396-70663418 AAGAGGCAGGGCCCCAGAGGAGG + Exonic
1139956570 16:70696082-70696104 ACCAGGAGGTGCCTCAGTGGAGG - Intronic
1140219372 16:73032914-73032936 ACAAATCAGAGCCCCAGTGGAGG + Intronic
1140518619 16:75563258-75563280 CCTAGTCAGTGAACCAGTGGAGG - Intergenic
1143213040 17:5203585-5203607 GCTGGGCATTGCCCTAGTGGGGG - Intergenic
1143278225 17:5730582-5730604 ACCAGGCACTGCACCTGTGGAGG + Intergenic
1143519892 17:7439127-7439149 CATTGGCAGTGCCCCAGTAGGGG + Exonic
1145140964 17:20448608-20448630 CCTAGACACTGGCCCAGTGGGGG + Intergenic
1147792491 17:43022168-43022190 ACTAGGCAGCGCAGCAGTGGCGG + Exonic
1148019174 17:44542222-44542244 GCCAGGCAGTGTACCAGTGGGGG - Intergenic
1148390502 17:47268800-47268822 ACTAGGCAGTGCCCGAGTGGGGG + Intronic
1149052675 17:52325479-52325501 ACTAGGCAGTGCCCCAGTAAGGG + Intergenic
1149135573 17:53359676-53359698 ACTAGGCAGTGCCCCTGTGGGGG - Intergenic
1151422837 17:74009752-74009774 ACCAGGCAGTCCCACAGTGGGGG - Intergenic
1151435409 17:74092765-74092787 ACTTGGCATTGCCCTAGTAGGGG + Intergenic
1151562233 17:74876882-74876904 GCTAGGAAGTGCCCAGGTGGAGG - Intergenic
1152522932 17:80870648-80870670 AGAAGGCAGTGCCCTGGTGGGGG + Intronic
1152835109 17:82524791-82524813 TCTTGGCAGTGAGCCAGTGGAGG + Intronic
1153011918 18:547196-547218 ATTAGGCAGTGACCCAGTAGGGG + Intergenic
1153844135 18:9033282-9033304 ACTAAGCATTGCCCTATTGGGGG - Intergenic
1153946344 18:10021377-10021399 ACTGGGTTTTGCCCCAGTGGTGG + Intergenic
1156154680 18:34287693-34287715 GCTAGGCAGTACCCCAGTGGGGG + Intergenic
1157202290 18:45669232-45669254 ACTAGACTGTGCTGCAGTGGGGG - Intronic
1157815080 18:50724329-50724351 ATGAGCCACTGCCCCAGTGGTGG + Intronic
1159697316 18:71575851-71575873 ACTAGGCAGTACCCCAGTGGGGG + Intergenic
1159713890 18:71797675-71797697 ACTAGGTATTGCCCCAGTGGGGG - Intergenic
1163110925 19:15160761-15160783 GGCAGGCAGTGCCCCAGTGGTGG + Exonic
1164607266 19:29608972-29608994 ACCAGGCTGTGCCCACGTGGTGG + Intronic
1166164921 19:40980673-40980695 ACTAAGCAGTGCCCCAGCAGAGG + Intergenic
1166834566 19:45659337-45659359 ACCAGGCAGTGCCCCTGTCCAGG - Intergenic
1167806446 19:51789572-51789594 ACTGGACATTGCCCTAGTGGAGG + Intronic
925305103 2:2842693-2842715 ACTGGGCGTTGCCCTAGTGGGGG - Intergenic
926564237 2:14452375-14452397 GCTGGGCATTGCCCTAGTGGGGG + Intergenic
929898253 2:45979954-45979976 AATAGGCAGTGCTCCATGGGAGG + Intronic
930687560 2:54325696-54325718 ACTAGGCAATGCTCCAGTGGGGG - Intergenic
931154137 2:59608378-59608400 ACTAGGCAGTGCTTTAGTGGGGG - Intergenic
932060779 2:68495607-68495629 ACTAGGCAGTGTCCCAAGTGGGG + Intronic
932583756 2:73009353-73009375 ACGAGGCAGTGGCCCAGGGGTGG + Intronic
934144192 2:89075469-89075491 ACTAAGCAGTGCCCCAGTAGGGG - Intergenic
934225051 2:90125079-90125101 ACTAAGCAGTGCCCCAGTAGGGG + Intergenic
935839945 2:107098303-107098325 ACTTGGCCGTGCTCCAGTAGAGG - Intergenic
936112720 2:109677996-109678018 ATCAGGCAGTGCACCCGTGGTGG + Intergenic
936788756 2:116125418-116125440 ATTAGGCAGTGGCCCAGTGGTGG + Intergenic
936792346 2:116164747-116164769 ACTAAGCAGTGCCCCAGTAGGGG - Intergenic
937206037 2:120237793-120237815 GCTAGGCAGTGTTCCAGTGGGGG - Intergenic
937941699 2:127291205-127291227 ACCAGGCAGAGCCACAGTGTTGG + Intronic
939249013 2:139662394-139662416 ACTATGCAATGCTCCAGTGGGGG + Intergenic
940156256 2:150660075-150660097 ACTAGCCATTGCCCTAGTAGGGG + Intergenic
940288948 2:152059195-152059217 ACTATGCAGTGCCCCAGTGGGGG - Intronic
940425930 2:153532069-153532091 ACTAAGCAGTGCCCCAGTGGGGG + Intergenic
940542961 2:155045685-155045707 AGTAGGCAATGGCCCAGTAGGGG + Intergenic
940598017 2:155819430-155819452 ATTAGGCATTGCCCCACTGGAGG - Intergenic
940790747 2:158027641-158027663 ACTAGACGGTACCCCAGTAGGGG + Intronic
941527001 2:166618487-166618509 ACTAGACAGTGCCCCAGTGGGGG - Intergenic
941570237 2:167161288-167161310 ACTAGGTGGTGCCCCAGTAGGGG + Intronic
942731693 2:179067190-179067212 ACTAGGCAGTGCCAGAGAGTGGG - Intergenic
943092966 2:183395897-183395919 ACTAGGCAGTGCCCCAGTACAGG - Intergenic
943690928 2:190868947-190868969 ACTTGGCATTGCCCCAGTAGAGG + Intergenic
943788198 2:191901636-191901658 ATTAGGCAGTGCCCCAATAGGGG - Intergenic
943876200 2:193071142-193071164 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
943936113 2:193919003-193919025 ACTAGGCAGGGTCCCATTGAGGG - Intergenic
944477750 2:200124810-200124832 ACTAAGCAGTGCCCCAGTGGGGG + Intergenic
944479734 2:200144401-200144423 ACTAGGCAGTACCGCAGTGGGGG + Intergenic
945019816 2:205559121-205559143 AGTAGGTATTGCTCCAGTGGTGG - Intronic
945360151 2:208886882-208886904 ACTAGGCAATGCCCCAGTAGGGG - Intergenic
945457124 2:210063373-210063395 ACTAGGTGGTGCCCCAGTAGGGG - Intronic
947744492 2:232500620-232500642 GCTAGGGAGTGGCCCAGTGTGGG + Intergenic
949048224 2:241881979-241882001 ACTTGGCTGGGCCCCAGTGAAGG - Intergenic
1171168445 20:22994002-22994024 GCTAGGCACTGTCCCAGTGCTGG - Intergenic
1174320660 20:49739240-49739262 ACTCGGCACTGCCCTTGTGGGGG + Intergenic
1175552674 20:59827318-59827340 ACCAGGAACAGCCCCAGTGGTGG - Intronic
1175572868 20:60037296-60037318 AGGGGGCAGTGTCCCAGTGGAGG + Intergenic
1175736513 20:61391015-61391037 AGGAGGCAGTGCCGCAGTGGGGG + Intronic
1177211427 21:18076782-18076804 ACTAGGCATTGCCCTAATGAGGG - Intronic
1177522115 21:22239322-22239344 ACTAGGCAATGGCCCAGTGGGGG - Intergenic
1178472671 21:32907372-32907394 AATAGGCAGGAGCCCAGTGGTGG + Intergenic
1178903339 21:36615354-36615376 ACTAGGCATTGCCCTAGTGAAGG + Intergenic
1179341684 21:40516746-40516768 ACTCTGCAGTGCCCCAGTGTGGG + Intronic
1180218759 21:46344546-46344568 CCTAGCCAGTTCCCCAGTTGGGG + Intronic
1182940268 22:34270090-34270112 ACTAGGCATTGCCCCAGTAGGGG + Intergenic
1183177501 22:36235111-36235133 ACTAGGCAGAGCCTCAGAGAGGG + Intronic
1183740578 22:39666572-39666594 TCTGGGCAGTGCCCCAGGTGAGG + Intronic
1185413269 22:50697092-50697114 TCTGAGCAGAGCCCCAGTGGAGG + Intergenic
949214653 3:1551484-1551506 ACTAAGCATTGTCCTAGTGGGGG - Intergenic
949600908 3:5596821-5596843 ACTAGGGAGTGCCACAGAGTGGG - Intergenic
949821752 3:8123514-8123536 ACTTGGCATTGCCCTAGCGGGGG + Intergenic
950611587 3:14130563-14130585 TCTTAGCACTGCCCCAGTGGTGG - Intronic
951180652 3:19654760-19654782 ACCAGGCAGTGCCCCAGCTGGGG + Intergenic
951446122 3:22782471-22782493 ACTAGGCAGTGTCCCAAGGAGGG + Intergenic
951449347 3:22819058-22819080 ACTAGGCAGTGCCCCAGTTGGGG + Intergenic
951866522 3:27314759-27314781 ACTAGGCAGAGACCTAGCGGAGG - Intronic
952589382 3:34932464-34932486 ACCAGGCAGTGCCCCAGTGGGGG - Intergenic
953192517 3:40701137-40701159 ACTAGGCATTGCTCTAATGGGGG - Intergenic
953377954 3:42444701-42444723 ACTGGGCAGTGCCCCAGTGAGGG - Intergenic
953408546 3:42673445-42673467 ACTGGCCAGTGCCCTAGTGGGGG - Intergenic
953446658 3:42974327-42974349 ATTAGGCAGTGCCCTAGTAGGGG - Intronic
954274789 3:49535079-49535101 AGTGAGCAGTGCCCCTGTGGGGG + Exonic
954591603 3:51788083-51788105 ACCAGGCAGTGCCCCAGTAGGGG - Intergenic
956067465 3:65412189-65412211 AGGAGGCAGTTCCGCAGTGGAGG - Intronic
956246248 3:67186520-67186542 ACTAGGCAGTACCTCAGTGTGGG + Intergenic
956546344 3:70407799-70407821 ACTAGGTGGTGCCCCAGCAGGGG + Intergenic
956572516 3:70712546-70712568 ACTAGTCAGTGCTCCAGTGGGGG + Intergenic
957674323 3:83347122-83347144 ACTAGGCGGTTCCCCGGTAGGGG - Intergenic
957923576 3:86778899-86778921 ACTAAGCATTGCCCTGGTGGAGG + Intergenic
958196260 3:90245570-90245592 ACTAGGCATTGCCCTGGTGGGGG + Intergenic
958419452 3:93914212-93914234 ACTAGGCATTGCCCTGGTGGGGG + Intronic
958555674 3:95673323-95673345 GCTGGGCATTGCCCCAGTGAGGG + Intergenic
959818508 3:110704131-110704153 ACTAGGTAGTGACCCAGTGAAGG + Intergenic
960121388 3:113951250-113951272 ACTGGGCAGTGCCCTAGTGGGGG + Intronic
960581483 3:119282854-119282876 ATGAGGCAGTGCCCCAGTGGGGG - Intergenic
961316327 3:126038245-126038267 ACTAGGCATTGGCCAAGTGGGGG - Intronic
961477456 3:127157592-127157614 ACTAGGCAGCCCCCCAATGGAGG + Intergenic
962461039 3:135612881-135612903 AATAGGCAGTGTCCCAGTGGGGG - Intergenic
962636655 3:137338662-137338684 ACTAACCAGTGCCCCAGTTGGGG - Intergenic
963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
963853360 3:150228872-150228894 TCAAGGCAGTGACCAAGTGGAGG - Intergenic
964719342 3:159756110-159756132 ACTAGACAGTACCTCAGTAGGGG + Intronic
964895504 3:161590625-161590647 ACTAGGCAGTGCCCCTGGTGGGG + Intergenic
965301529 3:167011256-167011278 ACTAGGCAGTGCCCCTGGTGGGG + Intergenic
966216450 3:177508132-177508154 ACTAGGCATTACCCTAGTGGGGG - Intergenic
967582773 3:191179363-191179385 AGTAGGCAGTGCCCCAGTTGAGG - Intergenic
967633918 3:191778611-191778633 ACCAGGTAGTGCCCCAGTGTGGG - Intergenic
967883630 3:194318536-194318558 ACTAGGCAGTGTCCTGGTGGGGG + Intergenic
968628782 4:1639569-1639591 AGTAGGCACTGCCCCAACGGAGG + Intronic
968864573 4:3199761-3199783 ACTAGGCTGTTCCGCAGTGATGG + Exonic
969157383 4:5223314-5223336 ACTAGGCATTGCCTCATTAGGGG - Intronic
969831502 4:9801308-9801330 ACCAGGCAGTGGCCCAGGAGGGG - Intronic
969997096 4:11324307-11324329 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
970339115 4:15086098-15086120 ACTAGGTGTTGCCCCAGTAGGGG + Intergenic
971022946 4:22556976-22556998 ACTAGGCATTGTCCTAGTGTAGG - Intergenic
971327427 4:25655726-25655748 GGTAGGCAGTGCCCCGGCGGCGG + Intronic
971510482 4:27417524-27417546 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
971710536 4:30105604-30105626 ACTAGGCAGTGCCTCTGTGTGGG + Intergenic
971815101 4:31477063-31477085 ACTAGGCAATGCCCAAGTCGGGG - Intergenic
971962556 4:33507763-33507785 ACTAGGCAGTGCCCTAGTTGGGG - Intergenic
973871317 4:55169697-55169719 ACTATGCCCTGCCCCAGAGGTGG + Intergenic
974485124 4:62494500-62494522 ATTAGGCAATGCCCCAGTGGGGG - Intergenic
974525747 4:63047894-63047916 ACTAAGCATTGCCCTAGTTGGGG + Intergenic
974666525 4:64969390-64969412 ACTAGGCAGTGTACAAGTGGGGG + Intergenic
974716897 4:65679181-65679203 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
974845997 4:67351693-67351715 CCTAAGCAGCTCCCCAGTGGAGG + Intergenic
974931477 4:68365612-68365634 ATGAGGTGGTGCCCCAGTGGAGG - Intergenic
975230264 4:71924361-71924383 ACAAGACAGTGCCCTAATGGGGG - Intergenic
975301685 4:72797795-72797817 ACTAGGCAGTTTCCCAGTGGGGG + Intergenic
976271911 4:83239024-83239046 ACTTGGCAGTGTGCCAATGGTGG - Intergenic
976715669 4:88120308-88120330 ACTAAGCAGTGCCTCAGTGGGGG - Intronic
976755963 4:88498193-88498215 ACTAGGCATTGCCTTAGTGGGGG - Intronic
978252492 4:106649798-106649820 ACTAGGCAGTGCCCCCAGTGGGG - Intergenic
978920267 4:114175257-114175279 ACTAGGCAGTACTCCAGTAGGGG + Intergenic
979087235 4:116428498-116428520 AATAGGCAGTGCCCCAGTGGGGG - Intergenic
979456126 4:120927825-120927847 ATTAGGCATTGCCCTGGTGGGGG - Intergenic
980727875 4:136788073-136788095 ACTAGGCAGTGCCCTGGTAGGGG - Intergenic
981286546 4:143025232-143025254 ACTTAGCAGAGACCCAGTGGTGG + Intergenic
981548223 4:145916165-145916187 ACTAGGCATTGCCCTAGTTGGGG + Intronic
981799318 4:148637300-148637322 ACTAGGCAGTGCCCCAGTTAGGG + Intergenic
981959786 4:150522886-150522908 ACTAGGCATTGCCCTAGTGGGGG - Intronic
982337636 4:154257991-154258013 ACGATGCAGGGCCCCAGTGTGGG + Intronic
982342962 4:154323508-154323530 TCTAGGCTGTGCATCAGTGGGGG - Intronic
982485329 4:155959085-155959107 ACTAGGGGGTGCCCCAGGAGGGG + Intergenic
982607944 4:157537906-157537928 ATTAGCCATTGCCCCATTGGGGG - Intergenic
982987744 4:162232199-162232221 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
983419214 4:167496290-167496312 ACTAGGCAGTGCCCCAGTTGGGG + Intergenic
983469288 4:168136784-168136806 ACTAGGCAGTGTCCCAGTGTGGG + Intronic
983713972 4:170754685-170754707 ACTAAACAGTTCCCCAGTAGGGG - Intergenic
984431905 4:179661051-179661073 ACTAAGCATTGCCCTAGTGGAGG - Intergenic
985337679 4:188913919-188913941 ACTAGGTGGTGCCCCAGTAGGGG + Intergenic
986014706 5:3747781-3747803 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
986533424 5:8761979-8762001 ACTAGGCAGTGCCCTAGTGAGGG - Intergenic
987033456 5:13996857-13996879 ACTAGGCATTGCCCTAGTATAGG + Intergenic
987154745 5:15077855-15077877 ACTGGGCAATGCCCTAGTGTAGG - Intergenic
987611093 5:20203555-20203577 AGGAGGCAGTGACCTAGTGGAGG + Intronic
987794390 5:22608039-22608061 ACTAGGCAATGCCTCAGTTGGGG - Intronic
987881296 5:23749510-23749532 ACTAGGCAGTGACCCAGTGGGGG + Intergenic
987983876 5:25121578-25121600 ACTGGGCAGTGCCCCAGTGGGGG + Intergenic
989130597 5:38103220-38103242 TTTAGGCAGTGCCTCACTGGTGG - Intergenic
989358044 5:40566978-40567000 ACTATGCCTTGCCCCAGAGGTGG + Intergenic
990093384 5:52083078-52083100 ACTAGGCAGTGCCCCAGTAGGGG + Intergenic
990213696 5:53507989-53508011 CCTTGGCACTGCCCCAGTAGAGG + Intergenic
991321950 5:65383761-65383783 ACTAGGCATTGCCCTAGTGGGGG + Intronic
992366906 5:76101468-76101490 GCTAGGCACTGCCCCAGCTGTGG + Intronic
993013131 5:82506713-82506735 ACTAAGCCCTGCCCCAGTTGCGG - Intergenic
993117545 5:83735638-83735660 ACTAGGCAGTGCACCAGTGGCGG - Intergenic
993421813 5:87712203-87712225 ACATGGCAGAGCCCCAGTGTTGG - Intergenic
993967149 5:94372293-94372315 GCTAGGCAGTGCCCCAGTGGGGG + Intronic
995049743 5:107688577-107688599 ACCAGGCACGGTCCCAGTGGTGG + Intergenic
995686299 5:114776242-114776264 ACTAGGCACTGCCCTAGTAGAGG + Intergenic
995915620 5:117241772-117241794 ACTAAGCGGTGTTCCAGTGGGGG - Intergenic
996098142 5:119420749-119420771 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
998812009 5:145975767-145975789 GCTAGGCACTGCCCCAGTAGGGG - Intronic
999499458 5:152132240-152132262 ACTAAGCATTGACCTAGTGGGGG + Intergenic
1000242299 5:159419585-159419607 GCTGGGCATTGCCCTAGTGGGGG + Intergenic
1000674618 5:164105600-164105622 ACTATGCAGTGTCCCAGTGGGGG - Intergenic
1000751074 5:165097449-165097471 ACTAGGCAGTGCCCCAGTAAGGG + Intergenic
1001181632 5:169526058-169526080 ACTAGACAGTGCCCCAGTAGGGG + Intergenic
1002757155 6:172799-172821 ACTAGGCAGTGCCCCAGGTGGGG - Intergenic
1004590162 6:17042963-17042985 ACTGGGCATTGCCCCATGGGAGG + Intergenic
1009284943 6:61804490-61804512 ACTAAGCAATGTACCAGTGGGGG + Intronic
1009392027 6:63155901-63155923 ACAAGCATGTGCCCCAGTGGAGG - Intergenic
1010055149 6:71556377-71556399 ACTAGGCAGTGCTTCAGTGTGGG - Intergenic
1010087561 6:71938372-71938394 ACTTGGCATTGCCCTAGTAGGGG + Intronic
1010884422 6:81218458-81218480 ACTCTGCAGTGCCACAGGGGTGG + Intergenic
1010898241 6:81392604-81392626 ATTAGGCAGTGTCCCAGTGGAGG - Intergenic
1011345832 6:86368889-86368911 ACCAGGCAGTGCCCTAGTAGAGG - Intergenic
1012118418 6:95333891-95333913 ACTATGCAGTACCTTAGTGGGGG + Intergenic
1012649579 6:101736296-101736318 ACTAGGCAGTGCCCCAGTAGGGG + Intronic
1012940576 6:105410388-105410410 ACCCAGCAGTGTCCCAGTGGTGG + Intergenic
1013503008 6:110771136-110771158 ACTAGCCTGTGCCCCACTAGGGG + Intronic
1013613398 6:111817884-111817906 ACCAGACAGTGCCCCAGTGGAGG - Intronic
1014068112 6:117150571-117150593 ACTAGGCAGTGCCCCAGTAGGGG + Intergenic
1014563053 6:122914089-122914111 ACTAGGCAGTGCCCCAGTTGGGG - Intergenic
1016229882 6:141789572-141789594 CATAGGCAGTGGCCAAGTGGTGG + Intergenic
1017309257 6:152957192-152957214 ACTAGCCATTGCCCTAGTGGGGG - Intergenic
1018527493 6:164729086-164729108 ACTAGGCAGTGCCTCAGTGAAGG - Intergenic
1018573767 6:165236853-165236875 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
1020754901 7:12190094-12190116 ACTAGGCACTGCCCAAGTACAGG - Intergenic
1020945533 7:14600959-14600981 ACTAGGCATTGTCCTAGTGGAGG + Intronic
1021750604 7:23795512-23795534 ACTAGGCAGTACACCAGTTGGGG - Intronic
1023715025 7:43035035-43035057 ACTAGGTGTTGTCCCAGTGGAGG - Intergenic
1023931430 7:44708726-44708748 AGCAGCCAGTGCCCCGGTGGTGG - Exonic
1024218669 7:47269728-47269750 ACTAGGCATTGCCCTAGCCGAGG + Intergenic
1024761522 7:52602681-52602703 ACTAGGCAGTGGACCAGTACAGG + Intergenic
1025058455 7:55784231-55784253 ATTAGGCATTGCCCTGGTGGGGG + Intergenic
1027584781 7:80044629-80044651 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1028646007 7:93097474-93097496 ACTAAACATTGCCACAGTGGGGG - Intergenic
1029356624 7:100057021-100057043 ACTAGGCATGGCCCCAGTTCTGG + Exonic
1030172827 7:106621531-106621553 ACTTGGCAGGGTTCCAGTGGAGG - Intergenic
1033885064 7:145934277-145934299 ACTAGTCAGTGCCCCAGTGCGGG - Intergenic
1033910732 7:146260319-146260341 ACTAGGCAGTGCCCCAGGTGGGG - Intronic
1035971612 8:4255801-4255823 GCCAGCCAGTGCCCCAGAGGAGG - Intronic
1038359903 8:26865826-26865848 GCTAGGCAGGTTCCCAGTGGTGG - Intronic
1043993157 8:86780825-86780847 ACTAGGCAGTGCCCCAGTTTGGG - Intergenic
1044273662 8:90275469-90275491 ACTAGGCAGCACGCCAGTGGGGG - Intergenic
1044324815 8:90847503-90847525 ACTAGGCAGTGCCTCAGGTGGGG + Intronic
1044363687 8:91318236-91318258 ACTGGGCAGTGCCACATTTGTGG + Exonic
1044496790 8:92896428-92896450 ACTAGGCATTGCCCTAGTCAGGG - Intronic
1044718600 8:95124036-95124058 ACTAGGCAGAGCCCCAGTGGGGG - Intergenic
1045062455 8:98421850-98421872 ACTAGGCACTGCTCCCTTGGGGG - Intronic
1045422127 8:102026719-102026741 ACTAGGCAGTGCCCCAGTGGAGG + Intronic
1045676620 8:104614804-104614826 ACTGGTCAGTGGCCCAGGGGTGG + Intronic
1045735995 8:105296842-105296864 ACTAGGCCGTACCCCAGTAGGGG + Intronic
1046146848 8:110171977-110171999 ACTAGGCAGTGCACCAGTGGGGG - Intergenic
1047012279 8:120685208-120685230 GCTAGGCACTGCCTTAGTGGGGG + Intronic
1047700579 8:127445625-127445647 ACTAAGCATTGCCCTAGTAGGGG - Intergenic
1047869977 8:129071684-129071706 ACTAGGCAGTGACCCTGTGTGGG - Intergenic
1048404609 8:134107032-134107054 ACTAGGCAGTGCCCCAGGAAAGG - Intergenic
1049341374 8:142114392-142114414 CCAAGGCAGTGCCCCAGGGAGGG + Intergenic
1050146802 9:2576826-2576848 ACTTGGCTGTGCTCCAGAGGTGG - Intergenic
1050148145 9:2591849-2591871 CCTTGGCACTGCCCCAGTAGAGG + Intergenic
1050929014 9:11301016-11301038 ATTAGGCAATGCACCAGTAGGGG + Intergenic
1052420345 9:28235096-28235118 ACCTGGCAGAGTCCCAGTGGTGG + Intronic
1052577752 9:30311996-30312018 ATTAGGCAGTGCCCCAGTGTGGG + Intergenic
1055175549 9:73313800-73313822 ACTAGGCAGTGTCCCAGTAGGGG + Intergenic
1057331669 9:94120878-94120900 ACTAGGCACTGCCCTAGTGGGGG - Intergenic
1058230369 9:102417427-102417449 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
1058309761 9:103485669-103485691 ACTAGGCAGTGCTCCAGATGGGG - Intergenic
1058499024 9:105591708-105591730 AGTAGGCAGTGCCCCAGTGGGGG + Intronic
1062639444 9:137510792-137510814 ACCAGGCAGTGCCCCCGTGTGGG + Intronic
1187133569 X:16525877-16525899 ACTAAGCAGTGCCCCAGTTGGGG + Intergenic
1187612238 X:20955279-20955301 ACTAAGCATTTCCCTAGTGGAGG + Intergenic
1187944811 X:24415875-24415897 ACTAGGCATTGTCCTAGAGGGGG - Intergenic
1188134918 X:26483648-26483670 ACTAGGCAGTGTCCCAGTGGGGG - Intergenic
1188166474 X:26870347-26870369 ACTACGCAGTGCTTCAGTGAGGG + Intergenic
1188821970 X:34786653-34786675 GCTGGGCATTGCCCTAGTGGGGG + Intergenic
1189170067 X:38900690-38900712 ACTAGGCATTGCCCTAGTGGGGG - Intergenic
1189254094 X:39623975-39623997 ACTAAGCATTGCCCTAGTGAGGG + Intergenic
1189435712 X:40990949-40990971 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1190772554 X:53527294-53527316 ACCAGGCAGTGTCCCAGTGGGGG - Intergenic
1191987711 X:67000549-67000571 ACTAGGCAGTGCCCCAGTGGAGG + Intergenic
1192704865 X:73518867-73518889 ACAAGGCATTGCCCTAATGGAGG + Intergenic
1192713556 X:73616474-73616496 ACTAGGCAGTGCCCCAGTGAGGG + Intronic
1193050689 X:77096329-77096351 ACTAGGCAGTGCCCTACCTGTGG - Intergenic
1193188266 X:78538971-78538993 ATTAGGTGGTGCCCCAGTAGGGG + Intergenic
1193247380 X:79244706-79244728 ACTCAGCACTGTCCCAGTGGTGG + Intergenic
1193370754 X:80694395-80694417 ACTAGGCAGTACCCCAGTGGGGG - Intronic
1193388220 X:80895358-80895380 ACTTGGCAATGCCCCAGTTGGGG - Intergenic
1193797258 X:85891730-85891752 ACTAGGCAGTGCCAGAATAGGGG - Intronic
1193865040 X:86720734-86720756 TCTAGGCAGTGCCCCAGTGGGGG + Intronic
1193879809 X:86908194-86908216 ACTAGGTATTGCTCCAGTGGGGG + Intergenic
1194149782 X:90309754-90309776 ACTAGGCAATGCCCCAAGTGGGG + Intergenic
1194168919 X:90557496-90557518 ACTAGGCTGTGCCCTGCTGGGGG - Intergenic
1194178838 X:90688387-90688409 ACTATTCAGTGCCCCAGTGGTGG + Intergenic
1194850258 X:98860188-98860210 ACTAGGCAGTGCCCCACTGGGGG - Intergenic
1195292441 X:103442135-103442157 ACTGGGCATTGCCCTAGTGAGGG - Intergenic
1195295642 X:103473755-103473777 ACTAGGTATTGCCCTAGTAGGGG - Intergenic
1195536337 X:106012984-106013006 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1196559336 X:117126801-117126823 ACTAGGTGGTGCCACAGTAGGGG - Intergenic
1196723388 X:118875475-118875497 ACTAGGCATTGCCCTAGTGGGGG - Intergenic
1197088651 X:122510134-122510156 ACTAGGCAGTGCCCCAGTGTGGG + Intergenic
1197342396 X:125288891-125288913 ACTAGGCACTGCCTTAGTGGGGG - Intergenic
1197431861 X:126376642-126376664 ACTAGGTGGTGCACCAGTAGGGG + Intergenic
1197439954 X:126475890-126475912 ACTAGGCAGTGCCCTAGTGGGGG + Intergenic
1197451856 X:126629107-126629129 ACTAGGTAGTGTTCCAGTGGGGG + Intergenic
1197606024 X:128586462-128586484 ACTAGGATTTGCCACAGTGGTGG + Intergenic
1197689673 X:129485047-129485069 ACTAGGCAGTGCCCTTGTTGGGG - Intronic
1198865660 X:141120472-141120494 ACTGGGCATTGCCCTAGTGGGGG + Intergenic
1198941696 X:141963835-141963857 ACTAGGCAGTGCCCTAGTGAGGG + Intergenic
1199929496 X:152504054-152504076 ACTAGGCATTGCTCTGGTGGAGG + Intergenic
1200162332 X:154015960-154015982 AGCAGGCACAGCCCCAGTGGCGG - Intronic
1200525502 Y:4270557-4270579 ACTATTCAGTGCCCCAGTGGTGG + Intergenic
1200742682 Y:6871120-6871142 ACTAGGGATTGCCACAGTGCAGG + Intronic