ID: 963539566

View in Genome Browser
Species Human (GRCh38)
Location 3:146567790-146567812
Sequence CAAAATGATGATAGTGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963539566_963539569 4 Left 963539566 3:146567790-146567812 CCCATATCACTATCATCATTTTG No data
Right 963539569 3:146567817-146567839 AAGCCATTCAACAAGTCTCTAGG 0: 1428
1: 1886
2: 1423
3: 807
4: 580
963539566_963539571 7 Left 963539566 3:146567790-146567812 CCCATATCACTATCATCATTTTG No data
Right 963539571 3:146567820-146567842 CCATTCAACAAGTCTCTAGGAGG 0: 131
1: 141
2: 110
3: 60
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963539566 Original CRISPR CAAAATGATGATAGTGATAT GGG (reversed) Intergenic
No off target data available for this crispr