ID: 963539741

View in Genome Browser
Species Human (GRCh38)
Location 3:146569976-146569998
Sequence GTTTTTGTACATTCATCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963539740_963539741 11 Left 963539740 3:146569942-146569964 CCATGTTATTTATAATACAAAGC No data
Right 963539741 3:146569976-146569998 GTTTTTGTACATTCATCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963539741 Original CRISPR GTTTTTGTACATTCATCTCA TGG Intergenic
No off target data available for this crispr