ID: 963545130

View in Genome Browser
Species Human (GRCh38)
Location 3:146647522-146647544
Sequence CATCCCAGCACCTTGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963545121_963545130 30 Left 963545121 3:146647469-146647491 CCTGTGCTGGTTACTACCTCATT No data
Right 963545130 3:146647522-146647544 CATCCCAGCACCTTGGCTGCTGG No data
963545123_963545130 14 Left 963545123 3:146647485-146647507 CCTCATTAAGTTGCTGGATTCTG No data
Right 963545130 3:146647522-146647544 CATCCCAGCACCTTGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963545130 Original CRISPR CATCCCAGCACCTTGGCTGC TGG Intergenic
No off target data available for this crispr