ID: 963545991

View in Genome Browser
Species Human (GRCh38)
Location 3:146658891-146658913
Sequence CTCCATGATCAAATGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963545991_963545998 20 Left 963545991 3:146658891-146658913 CCCACCTCCATTTGATCATGGAG No data
Right 963545998 3:146658934-146658956 ATAGCCCAGACCATTTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963545991 Original CRISPR CTCCATGATCAAATGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr