ID: 963546683

View in Genome Browser
Species Human (GRCh38)
Location 3:146668356-146668378
Sequence CACATGCATGTTTCTGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963546680_963546683 12 Left 963546680 3:146668321-146668343 CCTGTGATGTTTTGCTTAGGAAT No data
Right 963546683 3:146668356-146668378 CACATGCATGTTTCTGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963546683 Original CRISPR CACATGCATGTTTCTGCAAA AGG Intergenic
No off target data available for this crispr