ID: 963557849

View in Genome Browser
Species Human (GRCh38)
Location 3:146816936-146816958
Sequence CAGAGTACAAAACGTATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963557847_963557849 4 Left 963557847 3:146816909-146816931 CCATTGAATTATTGGTCTCAGAT No data
Right 963557849 3:146816936-146816958 CAGAGTACAAAACGTATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963557849 Original CRISPR CAGAGTACAAAACGTATTTC AGG Intergenic
No off target data available for this crispr