ID: 963558183

View in Genome Browser
Species Human (GRCh38)
Location 3:146823891-146823913
Sequence GTTAGCTGAACTAAAACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963558182_963558183 23 Left 963558182 3:146823845-146823867 CCTCTCAACTGGCAAGGTTGGAT No data
Right 963558183 3:146823891-146823913 GTTAGCTGAACTAAAACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963558183 Original CRISPR GTTAGCTGAACTAAAACTAC TGG Intergenic
No off target data available for this crispr