ID: 963572029

View in Genome Browser
Species Human (GRCh38)
Location 3:147009377-147009399
Sequence AGGGAGAGAAAAGTAATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963572029_963572038 25 Left 963572029 3:147009377-147009399 CCCACAATTACTTTTCTCTCCCT No data
Right 963572038 3:147009425-147009447 CTTGTCATGAGGCCACTGCCAGG No data
963572029_963572039 26 Left 963572029 3:147009377-147009399 CCCACAATTACTTTTCTCTCCCT No data
Right 963572039 3:147009426-147009448 TTGTCATGAGGCCACTGCCAGGG No data
963572029_963572036 14 Left 963572029 3:147009377-147009399 CCCACAATTACTTTTCTCTCCCT No data
Right 963572036 3:147009414-147009436 GATTCTTTTTCCTTGTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963572029 Original CRISPR AGGGAGAGAAAAGTAATTGT GGG (reversed) Intergenic
No off target data available for this crispr