ID: 963572888

View in Genome Browser
Species Human (GRCh38)
Location 3:147019970-147019992
Sequence CCTTCTTTTTTGAGTTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963572888_963572899 25 Left 963572888 3:147019970-147019992 CCCCCCAAACTCAAAAAAGAAGG No data
Right 963572899 3:147020018-147020040 GATTTGACTGGTGCTTTGAAGGG No data
963572888_963572898 24 Left 963572888 3:147019970-147019992 CCCCCCAAACTCAAAAAAGAAGG No data
Right 963572898 3:147020017-147020039 AGATTTGACTGGTGCTTTGAAGG No data
963572888_963572897 13 Left 963572888 3:147019970-147019992 CCCCCCAAACTCAAAAAAGAAGG No data
Right 963572897 3:147020006-147020028 ATAAATAGTTAAGATTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963572888 Original CRISPR CCTTCTTTTTTGAGTTTGGG GGG (reversed) Intergenic
No off target data available for this crispr