ID: 963575885

View in Genome Browser
Species Human (GRCh38)
Location 3:147060149-147060171
Sequence CGGCAAACAGCAGTGTTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963575885_963575891 23 Left 963575885 3:147060149-147060171 CCGTCCAACACTGCTGTTTGCCG No data
Right 963575891 3:147060195-147060217 TCCATCCCTCCAGATCTGGCAGG 0: 17
1: 36
2: 91
3: 149
4: 298
963575885_963575893 24 Left 963575885 3:147060149-147060171 CCGTCCAACACTGCTGTTTGCCG No data
Right 963575893 3:147060196-147060218 CCATCCCTCCAGATCTGGCAGGG 0: 17
1: 43
2: 88
3: 172
4: 289
963575885_963575890 19 Left 963575885 3:147060149-147060171 CCGTCCAACACTGCTGTTTGCCG No data
Right 963575890 3:147060191-147060213 GACTTCCATCCCTCCAGATCTGG 0: 29
1: 69
2: 102
3: 85
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963575885 Original CRISPR CGGCAAACAGCAGTGTTGGA CGG (reversed) Intergenic
No off target data available for this crispr