ID: 963576623

View in Genome Browser
Species Human (GRCh38)
Location 3:147068406-147068428
Sequence ATGTCCTTTTAGAAGAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963576623_963576630 23 Left 963576623 3:147068406-147068428 CCTTCCCTCTTCTAAAAGGACAT No data
Right 963576630 3:147068452-147068474 GGTTTAAATTAAAGGAAGCAAGG No data
963576623_963576627 2 Left 963576623 3:147068406-147068428 CCTTCCCTCTTCTAAAAGGACAT No data
Right 963576627 3:147068431-147068453 TTTGTTAGGTCCTTTTTGCATGG No data
963576623_963576629 15 Left 963576623 3:147068406-147068428 CCTTCCCTCTTCTAAAAGGACAT No data
Right 963576629 3:147068444-147068466 TTTTGCATGGTTTAAATTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963576623 Original CRISPR ATGTCCTTTTAGAAGAGGGA AGG (reversed) Intergenic
No off target data available for this crispr