ID: 963579824

View in Genome Browser
Species Human (GRCh38)
Location 3:147111277-147111299
Sequence CATGTGGCCCACAAGAATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963579824_963579827 30 Left 963579824 3:147111277-147111299 CCCATATTCTTGTGGGCCACATG No data
Right 963579827 3:147111330-147111352 GTCCTTTTCCCACTTTTTAATGG 0: 22
1: 1334
2: 4641
3: 13712
4: 11280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963579824 Original CRISPR CATGTGGCCCACAAGAATAT GGG (reversed) Intergenic
No off target data available for this crispr