ID: 963580612

View in Genome Browser
Species Human (GRCh38)
Location 3:147122548-147122570
Sequence CTGTATATGCAGAAGGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963580612_963580619 10 Left 963580612 3:147122548-147122570 CCACTCTCCTTCTGCATATACAG No data
Right 963580619 3:147122581-147122603 GAACAACCCACTTTATCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963580612 Original CRISPR CTGTATATGCAGAAGGAGAG TGG (reversed) Intergenic
No off target data available for this crispr