ID: 963580697

View in Genome Browser
Species Human (GRCh38)
Location 3:147123158-147123180
Sequence CTGTGCTTAAGTAGATACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963580694_963580697 9 Left 963580694 3:147123126-147123148 CCTTTAACACATTGCTTTGTATC No data
Right 963580697 3:147123158-147123180 CTGTGCTTAAGTAGATACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963580697 Original CRISPR CTGTGCTTAAGTAGATACCA AGG Intergenic
No off target data available for this crispr