ID: 963583143

View in Genome Browser
Species Human (GRCh38)
Location 3:147152222-147152244
Sequence GGTTTTCGATGTTCACCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963583140_963583143 26 Left 963583140 3:147152173-147152195 CCACAGATTACATTGTTTAAGAA No data
Right 963583143 3:147152222-147152244 GGTTTTCGATGTTCACCTACAGG No data
963583139_963583143 27 Left 963583139 3:147152172-147152194 CCCACAGATTACATTGTTTAAGA No data
Right 963583143 3:147152222-147152244 GGTTTTCGATGTTCACCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963583143 Original CRISPR GGTTTTCGATGTTCACCTAC AGG Intergenic
No off target data available for this crispr