ID: 963587712

View in Genome Browser
Species Human (GRCh38)
Location 3:147214202-147214224
Sequence ATAGGCCATCTGTCTGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963587712_963587720 28 Left 963587712 3:147214202-147214224 CCCACTACAGACAGATGGCCTAT No data
Right 963587720 3:147214253-147214275 GCAGAAATAGCAGGGATGCCAGG No data
963587712_963587718 20 Left 963587712 3:147214202-147214224 CCCACTACAGACAGATGGCCTAT No data
Right 963587718 3:147214245-147214267 TAGGACCAGCAGAAATAGCAGGG No data
963587712_963587715 1 Left 963587712 3:147214202-147214224 CCCACTACAGACAGATGGCCTAT No data
Right 963587715 3:147214226-147214248 TTGAAAAATGACACCAGAGTAGG No data
963587712_963587717 19 Left 963587712 3:147214202-147214224 CCCACTACAGACAGATGGCCTAT No data
Right 963587717 3:147214244-147214266 GTAGGACCAGCAGAAATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963587712 Original CRISPR ATAGGCCATCTGTCTGTAGT GGG (reversed) Intergenic
No off target data available for this crispr