ID: 963587714

View in Genome Browser
Species Human (GRCh38)
Location 3:147214220-147214242
Sequence CTGGTGTCATTTTTCAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963587714_963587718 2 Left 963587714 3:147214220-147214242 CCTATCTTGAAAAATGACACCAG No data
Right 963587718 3:147214245-147214267 TAGGACCAGCAGAAATAGCAGGG No data
963587714_963587720 10 Left 963587714 3:147214220-147214242 CCTATCTTGAAAAATGACACCAG No data
Right 963587720 3:147214253-147214275 GCAGAAATAGCAGGGATGCCAGG No data
963587714_963587717 1 Left 963587714 3:147214220-147214242 CCTATCTTGAAAAATGACACCAG No data
Right 963587717 3:147214244-147214266 GTAGGACCAGCAGAAATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963587714 Original CRISPR CTGGTGTCATTTTTCAAGAT AGG (reversed) Intergenic
No off target data available for this crispr