ID: 963587715

View in Genome Browser
Species Human (GRCh38)
Location 3:147214226-147214248
Sequence TTGAAAAATGACACCAGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963587712_963587715 1 Left 963587712 3:147214202-147214224 CCCACTACAGACAGATGGCCTAT No data
Right 963587715 3:147214226-147214248 TTGAAAAATGACACCAGAGTAGG No data
963587713_963587715 0 Left 963587713 3:147214203-147214225 CCACTACAGACAGATGGCCTATC No data
Right 963587715 3:147214226-147214248 TTGAAAAATGACACCAGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963587715 Original CRISPR TTGAAAAATGACACCAGAGT AGG Intergenic
No off target data available for this crispr