ID: 963587717

View in Genome Browser
Species Human (GRCh38)
Location 3:147214244-147214266
Sequence GTAGGACCAGCAGAAATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963587714_963587717 1 Left 963587714 3:147214220-147214242 CCTATCTTGAAAAATGACACCAG No data
Right 963587717 3:147214244-147214266 GTAGGACCAGCAGAAATAGCAGG No data
963587713_963587717 18 Left 963587713 3:147214203-147214225 CCACTACAGACAGATGGCCTATC No data
Right 963587717 3:147214244-147214266 GTAGGACCAGCAGAAATAGCAGG No data
963587712_963587717 19 Left 963587712 3:147214202-147214224 CCCACTACAGACAGATGGCCTAT No data
Right 963587717 3:147214244-147214266 GTAGGACCAGCAGAAATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963587717 Original CRISPR GTAGGACCAGCAGAAATAGC AGG Intergenic
No off target data available for this crispr