ID: 963587718 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:147214245-147214267 |
| Sequence | TAGGACCAGCAGAAATAGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 963587713_963587718 | 19 | Left | 963587713 | 3:147214203-147214225 | CCACTACAGACAGATGGCCTATC | No data | ||
| Right | 963587718 | 3:147214245-147214267 | TAGGACCAGCAGAAATAGCAGGG | No data | ||||
| 963587714_963587718 | 2 | Left | 963587714 | 3:147214220-147214242 | CCTATCTTGAAAAATGACACCAG | No data | ||
| Right | 963587718 | 3:147214245-147214267 | TAGGACCAGCAGAAATAGCAGGG | No data | ||||
| 963587712_963587718 | 20 | Left | 963587712 | 3:147214202-147214224 | CCCACTACAGACAGATGGCCTAT | No data | ||
| Right | 963587718 | 3:147214245-147214267 | TAGGACCAGCAGAAATAGCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 963587718 | Original CRISPR | TAGGACCAGCAGAAATAGCA GGG | Intergenic | ||
| No off target data available for this crispr | |||||