ID: 963587718

View in Genome Browser
Species Human (GRCh38)
Location 3:147214245-147214267
Sequence TAGGACCAGCAGAAATAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963587713_963587718 19 Left 963587713 3:147214203-147214225 CCACTACAGACAGATGGCCTATC No data
Right 963587718 3:147214245-147214267 TAGGACCAGCAGAAATAGCAGGG No data
963587714_963587718 2 Left 963587714 3:147214220-147214242 CCTATCTTGAAAAATGACACCAG No data
Right 963587718 3:147214245-147214267 TAGGACCAGCAGAAATAGCAGGG No data
963587712_963587718 20 Left 963587712 3:147214202-147214224 CCCACTACAGACAGATGGCCTAT No data
Right 963587718 3:147214245-147214267 TAGGACCAGCAGAAATAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963587718 Original CRISPR TAGGACCAGCAGAAATAGCA GGG Intergenic
No off target data available for this crispr