ID: 963587720

View in Genome Browser
Species Human (GRCh38)
Location 3:147214253-147214275
Sequence GCAGAAATAGCAGGGATGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963587713_963587720 27 Left 963587713 3:147214203-147214225 CCACTACAGACAGATGGCCTATC No data
Right 963587720 3:147214253-147214275 GCAGAAATAGCAGGGATGCCAGG No data
963587716_963587720 -9 Left 963587716 3:147214239-147214261 CCAGAGTAGGACCAGCAGAAATA No data
Right 963587720 3:147214253-147214275 GCAGAAATAGCAGGGATGCCAGG No data
963587712_963587720 28 Left 963587712 3:147214202-147214224 CCCACTACAGACAGATGGCCTAT No data
Right 963587720 3:147214253-147214275 GCAGAAATAGCAGGGATGCCAGG No data
963587714_963587720 10 Left 963587714 3:147214220-147214242 CCTATCTTGAAAAATGACACCAG No data
Right 963587720 3:147214253-147214275 GCAGAAATAGCAGGGATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963587720 Original CRISPR GCAGAAATAGCAGGGATGCC AGG Intergenic
No off target data available for this crispr