ID: 963597752

View in Genome Browser
Species Human (GRCh38)
Location 3:147349295-147349317
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963597752_963597756 -6 Left 963597752 3:147349295-147349317 CCAGGCCAATTCTCAGCCTAACA No data
Right 963597756 3:147349312-147349334 CTAACAAAGAGGATGTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963597752 Original CRISPR TGTTAGGCTGAGAATTGGCC TGG (reversed) Intergenic
No off target data available for this crispr