ID: 963600310

View in Genome Browser
Species Human (GRCh38)
Location 3:147372765-147372787
Sequence CTTCTCCAGTCCATCTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963600310_963600313 16 Left 963600310 3:147372765-147372787 CCTTTAAAGATGGACTGGAGAAG No data
Right 963600313 3:147372804-147372826 GGCGCTCACTTTTCCACTTTTGG No data
963600310_963600312 -5 Left 963600310 3:147372765-147372787 CCTTTAAAGATGGACTGGAGAAG No data
Right 963600312 3:147372783-147372805 AGAAGCTCTTTTGGAAGACAAGG No data
963600310_963600314 17 Left 963600310 3:147372765-147372787 CCTTTAAAGATGGACTGGAGAAG No data
Right 963600314 3:147372805-147372827 GCGCTCACTTTTCCACTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963600310 Original CRISPR CTTCTCCAGTCCATCTTTAA AGG (reversed) Intergenic
No off target data available for this crispr