ID: 963600424

View in Genome Browser
Species Human (GRCh38)
Location 3:147373552-147373574
Sequence AGGGTGGGGTGGCCAGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963600424_963600432 10 Left 963600424 3:147373552-147373574 CCATCTGCTGGCCACCCCACCCT No data
Right 963600432 3:147373585-147373607 GCTCCTGACCTTGTAGATGACGG No data
963600424_963600435 20 Left 963600424 3:147373552-147373574 CCATCTGCTGGCCACCCCACCCT No data
Right 963600435 3:147373595-147373617 TTGTAGATGACGGAATTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963600424 Original CRISPR AGGGTGGGGTGGCCAGCAGA TGG (reversed) Intergenic