ID: 963602646

View in Genome Browser
Species Human (GRCh38)
Location 3:147391395-147391417
Sequence CGCTCTCTGCACGAGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963602646_963602661 30 Left 963602646 3:147391395-147391417 CCCTTTCCCTCGTGCAGAGAGCG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 963602661 3:147391448-147391470 CCCTCCCGCCTTCCTCCTCTGGG 0: 1
1: 0
2: 5
3: 64
4: 546
963602646_963602659 29 Left 963602646 3:147391395-147391417 CCCTTTCCCTCGTGCAGAGAGCG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 963602659 3:147391447-147391469 TCCCTCCCGCCTTCCTCCTCTGG 0: 1
1: 0
2: 7
3: 87
4: 527

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963602646 Original CRISPR CGCTCTCTGCACGAGGGAAA GGG (reversed) Intronic
901380344 1:8869462-8869484 CATTCTGTACACGAGGGAAAAGG - Intronic
903875866 1:26472682-26472704 CGCTCCCTGCACCAGGGAGGCGG - Intronic
905562879 1:38941439-38941461 GGCTATCTTCCCGAGGGAAATGG - Intronic
905684922 1:39901438-39901460 CGCTCCCTGCGGGAGGGAAGGGG + Exonic
905798198 1:40827208-40827230 TGCTCTGTGCACTAGGGACACGG + Intronic
908269900 1:62412344-62412366 GGCTCTCAGCAAGAGGGATAGGG - Intergenic
923222313 1:231906468-231906490 TGCTTTATGCACGAGGGATATGG + Intronic
1062926665 10:1321241-1321263 TGCTCTCTGCAAGAGAGAAGAGG - Intronic
1079128673 11:17735416-17735438 CGCTCTCGGCGCGGGGGAGATGG - Exonic
1087936386 11:104038194-104038216 TGATCTCTGGACAAGGGAAATGG - Exonic
1091269157 11:134293476-134293498 CACTCTCTTCACAGGGGAAAGGG - Intronic
1091671964 12:2458280-2458302 CGCTCTCTGAATCAGGGGAAGGG + Intronic
1097145584 12:56937291-56937313 CACTCTCTCCATGATGGAAATGG - Intergenic
1103218452 12:119222771-119222793 CTCTCTTTGCAAGTGGGAAATGG - Intergenic
1113542712 13:111121600-111121622 CTCTCACTGCACGAGGGAGGTGG + Intronic
1114471813 14:22968328-22968350 CTCTCTCAGGACCAGGGAAATGG - Intronic
1128727768 15:70000482-70000504 GGCTCTCAGCAGGAGGGAGAGGG - Intergenic
1137253967 16:46760150-46760172 CAGTCTCTCCACGAGTGAAATGG - Intronic
1137706395 16:50538719-50538741 GGCTGTCTCCAAGAGGGAAAAGG - Intergenic
1138294448 16:55874304-55874326 CGCTCTCAGCAGAAGGGAGATGG - Intronic
1140948845 16:79796627-79796649 GTCTCTCTGCAGAAGGGAAAAGG + Intergenic
1141916402 16:87100169-87100191 CGCTCTCTGCATGCTGGAATTGG - Intronic
1144598197 17:16589203-16589225 CGCTCCCTGCGAGAGGGAACTGG + Intergenic
1147791961 17:43019641-43019663 GCCTCTGTGCAGGAGGGAAAGGG + Intronic
1151436248 17:74099620-74099642 TGATCTCTGCAGGAGGGAAATGG - Intergenic
1152478290 17:80532787-80532809 GGCTCTCTGCAGGGGGTAAAAGG + Intergenic
1152748996 17:82053974-82053996 GGTTCTCTGCACGAAGGAGAGGG - Exonic
1157251230 18:46098079-46098101 CGCTCTCTGCAGGAGGGCGAGGG - Intronic
1158626792 18:59078543-59078565 CGCTTTCTCCACGCTGGAAATGG + Intergenic
1158873611 18:61711919-61711941 AGCTTTGTGCACCAGGGAAATGG + Intergenic
1158956653 18:62546632-62546654 CTCTCTCAGCATGAGGGACAGGG - Intronic
1161473170 19:4471395-4471417 CGCTCTCTGCACTTGGAAGATGG - Intergenic
1161608672 19:5229129-5229151 CGATGTTTGCACCAGGGAAATGG - Intronic
1164776386 19:30856826-30856848 CCCTCACTGCACAAGGGAACAGG + Intergenic
1165743920 19:38219138-38219160 TGCTCTTTGCAGGAGGGAAGAGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
926330548 2:11821865-11821887 CGCCTTCTGCAGGAGGGAACAGG - Intronic
927945212 2:27131503-27131525 CACTCCCTGCAGGAGGGAAAGGG + Exonic
928182184 2:29076139-29076161 CACTGTCTGCAGGAGGGAGAGGG + Intergenic
934715668 2:96541962-96541984 GGCTCTGTGGAGGAGGGAAAAGG - Intronic
936043538 2:109168475-109168497 GGCTCTCAGCAGGAGGGAGAGGG + Intronic
937283302 2:120735359-120735381 CGCTCGCTGCCCGCGGGAAGAGG + Intergenic
939041150 2:137190805-137190827 AACTCTCCACACGAGGGAAAAGG - Intronic
947533705 2:230928093-230928115 CACCCTCTGCACCAGGGTAAGGG + Intronic
948908548 2:240991629-240991651 TGCTCTCTGCCGGAGGGGAAGGG - Intronic
1170715015 20:18823854-18823876 TGCTCTTTGCATGAGGAAAAGGG + Intronic
1172315717 20:33952652-33952674 CTCTCACTGCTCTAGGGAAAGGG + Intergenic
1175370019 20:58481856-58481878 CGTTCTCTGCGCGAGTGGAAAGG - Intronic
1175918445 20:62438512-62438534 CTCTCTCTGCACAAGGGAACTGG - Intergenic
1176173852 20:63708449-63708471 CGGTGTCTCCCCGAGGGAAAGGG + Intronic
1178580966 21:33838323-33838345 CGCTCTCTGCACCATGTGAAAGG - Intronic
1179162412 21:38909309-38909331 CTATCTCAGCAGGAGGGAAAAGG + Intergenic
960435359 3:117619876-117619898 CCCTCTCTGTACGAGGGTGAGGG + Intergenic
963602646 3:147391395-147391417 CGCTCTCTGCACGAGGGAAAGGG - Intronic
968771548 4:2510755-2510777 CGTGCTCAGCAAGAGGGAAAGGG + Intronic
976620420 4:87121240-87121262 CTCTCTCTTCAGGAGGAAAAAGG - Intronic
980430815 4:132691378-132691400 ACCTCTCTGCAGGAGCGAAAAGG - Intergenic
984702993 4:182830280-182830302 GGCTCTGTGCAGGAGGCAAAGGG - Intergenic
986401718 5:7388699-7388721 AGCTCTCTGCACAAGGGAAGTGG + Intergenic
986408259 5:7448332-7448354 AACTCTGAGCACGAGGGAAAAGG - Intronic
991012800 5:61901388-61901410 CCTTCTCTGCATCAGGGAAATGG + Intergenic
995343231 5:111083508-111083530 TGCTCTGTGCAGAAGGGAAAAGG + Intergenic
997379316 5:133423997-133424019 CGCTGTGTGCACGAGGGCAAAGG + Intronic
998850004 5:146343311-146343333 CGCACTCAGGAGGAGGGAAAGGG - Intergenic
999839452 5:155409893-155409915 CACCTTCTGCACGTGGGAAATGG + Intergenic
1007077852 6:39079245-39079267 CTCTCTCTGCTAGAAGGAAAGGG - Intronic
1020481751 7:8669725-8669747 TACTCTCTGCTTGAGGGAAAGGG - Intronic
1021040554 7:15857007-15857029 TGCTCTCTGGAAGAGGCAAAAGG - Intergenic
1021463617 7:20916545-20916567 CTCTCTCTGCCAAAGGGAAAGGG + Intergenic
1024472470 7:49777192-49777214 CGCCCTCTGCAGGTGGGAAAAGG - Intronic
1029508960 7:100981353-100981375 CACTCGCTGCAGGAGGGACAAGG - Intronic
1035729132 8:1842334-1842356 AGCTCTCTGCACTAGGATAAGGG + Intronic
1035867513 8:3100872-3100894 CCCTCTGTGAACTAGGGAAAAGG + Intronic
1037982533 8:23264603-23264625 TACTCTCTTCACTAGGGAAAGGG - Intergenic
1042463489 8:69098870-69098892 CACTTTCTGCACGTGTGAAATGG + Intergenic
1049775447 8:144401789-144401811 CCCTCTCTGCAGCAGGGAGAAGG + Intronic
1059474097 9:114530031-114530053 GGCTCCCTGGACCAGGGAAAGGG - Intergenic
1060523742 9:124309003-124309025 GGCTCTCAGCAGAAGGGAAAGGG - Intronic
1062699832 9:137893049-137893071 GGCTCTCTCCAGGAGGGCAAAGG + Intronic
1200911651 Y:8536531-8536553 CTCACACTGCAAGAGGGAAAGGG - Intergenic
1202152660 Y:21857278-21857300 CTCACACTGCAAGAGGGAAAGGG + Intergenic