ID: 963603668

View in Genome Browser
Species Human (GRCh38)
Location 3:147396965-147396987
Sequence AGCGTGGGTCGGCAAGCAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963603668_963603674 -1 Left 963603668 3:147396965-147396987 CCGGCTGCTTGCCGACCCACGCT 0: 1
1: 0
2: 0
3: 8
4: 82
Right 963603674 3:147396987-147397009 TCCCCGGAGCTCCCTGTACCGGG 0: 1
1: 0
2: 2
3: 26
4: 190
963603668_963603682 28 Left 963603668 3:147396965-147396987 CCGGCTGCTTGCCGACCCACGCT 0: 1
1: 0
2: 0
3: 8
4: 82
Right 963603682 3:147397016-147397038 ACACCACTGCCACCTGACAGTGG 0: 1
1: 0
2: 0
3: 19
4: 153
963603668_963603684 30 Left 963603668 3:147396965-147396987 CCGGCTGCTTGCCGACCCACGCT 0: 1
1: 0
2: 0
3: 8
4: 82
Right 963603684 3:147397018-147397040 ACCACTGCCACCTGACAGTGGGG 0: 1
1: 0
2: 1
3: 15
4: 144
963603668_963603673 -2 Left 963603668 3:147396965-147396987 CCGGCTGCTTGCCGACCCACGCT 0: 1
1: 0
2: 0
3: 8
4: 82
Right 963603673 3:147396986-147397008 CTCCCCGGAGCTCCCTGTACCGG 0: 1
1: 0
2: 1
3: 15
4: 145
963603668_963603683 29 Left 963603668 3:147396965-147396987 CCGGCTGCTTGCCGACCCACGCT 0: 1
1: 0
2: 0
3: 8
4: 82
Right 963603683 3:147397017-147397039 CACCACTGCCACCTGACAGTGGG 0: 1
1: 0
2: 2
3: 17
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963603668 Original CRISPR AGCGTGGGTCGGCAAGCAGC CGG (reversed) Intronic