ID: 963605287

View in Genome Browser
Species Human (GRCh38)
Location 3:147407759-147407781
Sequence CAAAAAATGCACGCGGATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963605287_963605290 -2 Left 963605287 3:147407759-147407781 CCCGCATCCGCGTGCATTTTTTG 0: 1
1: 0
2: 0
3: 1
4: 47
Right 963605290 3:147407780-147407802 TGAAATGCATAAATGTTGCTCGG 0: 1
1: 0
2: 3
3: 30
4: 268
963605287_963605291 19 Left 963605287 3:147407759-147407781 CCCGCATCCGCGTGCATTTTTTG 0: 1
1: 0
2: 0
3: 1
4: 47
Right 963605291 3:147407801-147407823 GGCTTAATTGATTGAGTCACAGG 0: 1
1: 0
2: 2
3: 16
4: 187
963605287_963605292 20 Left 963605287 3:147407759-147407781 CCCGCATCCGCGTGCATTTTTTG 0: 1
1: 0
2: 0
3: 1
4: 47
Right 963605292 3:147407802-147407824 GCTTAATTGATTGAGTCACAGGG 0: 1
1: 0
2: 1
3: 5
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963605287 Original CRISPR CAAAAAATGCACGCGGATGC GGG (reversed) Intronic
900925545 1:5703938-5703960 TAGAAAATGCACGTGGAGGCTGG + Intergenic
902264981 1:15256826-15256848 CAGAAACTGCAGGGGGATGCAGG + Intronic
903429276 1:23280105-23280127 CAAAAAATGGAAACTGATGCAGG + Intergenic
903773047 1:25776191-25776213 TAAAAAATGCAGGGGTATGCGGG - Intronic
912428905 1:109618653-109618675 CAAAAAATAAACGCTAATGCAGG - Intronic
912922401 1:113882036-113882058 CAAAAAGTGCAGGAGGCTGCAGG + Intronic
919626866 1:199919671-199919693 CAAAAAATAAACAAGGATGCCGG - Intergenic
1067359114 10:45560655-45560677 GAAAAAATGCACTCACATGCAGG - Intronic
1069793136 10:71036118-71036140 CAAAAGATGCACTTGAATGCTGG - Intergenic
1084780699 11:71406453-71406475 GATAAAATGCACATGGATGCTGG - Intergenic
1091119340 11:133043648-133043670 CAAAAAATGCATGAGGAGGAAGG - Intronic
1093504974 12:19854590-19854612 AAAAAAATGTACGTGGAAGCGGG - Intergenic
1095684929 12:45022724-45022746 CAAAAAATCCAGGCAGATGTAGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1106418990 13:29569923-29569945 CAAACAAAGCACACGGCTGCTGG + Intronic
1111179991 13:84651662-84651684 CAAAAAAAGCAAGCAGATGTTGG + Intergenic
1118328421 14:64797174-64797196 AAAAAAATGGACTCGGAGGCTGG + Intronic
1123192628 14:106585884-106585906 ACAAAAAGGCACGCGGCTGCCGG + Intergenic
1125342599 15:38689551-38689573 CAAAACATGCATGTGGATGAAGG + Intergenic
1138107269 16:54294847-54294869 CAAAGAATGCAAGGGGTTGCTGG + Intergenic
1155996692 18:32338102-32338124 CAAAAAATGCAGACGGAGGAAGG + Intronic
1156738805 18:40298771-40298793 CTAAAAATACAAGCTGATGCAGG - Intergenic
1163549021 19:17954883-17954905 CAAAAATTGCCCGGGGATGGTGG + Intronic
937538605 2:122922242-122922264 CAAAAATTGCACGTGAATGTTGG + Intergenic
938282702 2:130076255-130076277 CAAAAAATATACACAGATGCAGG + Intronic
938333336 2:130464826-130464848 CAAAAAATATACACAGATGCAGG + Intronic
938356476 2:130655845-130655867 CAAAAAATATACACAGATGCAGG - Intronic
938432911 2:131262650-131262672 CAAAAAATATACACAGATGCAGG - Intronic
938476975 2:131625234-131625256 CAAAAAATATACACAGATGCAGG - Intergenic
939334072 2:140802587-140802609 CTAAAAATGCAGACTGATGCAGG - Intronic
945097058 2:206230134-206230156 CAATAAATGCACCAGGATTCAGG - Intergenic
1171422322 20:25025438-25025460 CAGAAAATGAACGCAGATGCTGG - Intronic
1183435476 22:37791964-37791986 CAATAAATGAATGAGGATGCAGG - Intergenic
963605287 3:147407759-147407781 CAAAAAATGCACGCGGATGCGGG - Intronic
964398618 3:156274043-156274065 CAAAAAATGCATATGGATGTTGG + Intronic
970236551 4:13964634-13964656 CAAAATTTGCATGTGGATGCTGG + Intergenic
972334582 4:38096063-38096085 GAAAAAATGCACTCGGCTGTTGG + Exonic
980486450 4:133463070-133463092 CAAGAAATGCAAGCTCATGCTGG - Intergenic
993841962 5:92890915-92890937 CAAAAAGTGCATGTGGGTGCAGG - Intergenic
1031424701 7:121591212-121591234 CATAAAAAGCACCCGGAGGCAGG - Intergenic
1032283463 7:130524340-130524362 GAAAAAATGCAGGAGGGTGCAGG + Intronic
1040716077 8:50254350-50254372 CAAAAAAGGTACACGGATGAAGG - Intronic
1049310759 8:141932576-141932598 CCAACGATGCACACGGATGCAGG + Intergenic
1050154143 9:2648030-2648052 CCAAAAATGAACGTGGATACAGG + Intronic
1051893808 9:21968615-21968637 CAAAAGATGCCTGGGGATGCGGG - Exonic
1185878018 X:3715076-3715098 CACAAAATGCAGGTGGAGGCTGG - Intergenic
1190540901 X:51477548-51477570 AAAAAAAAGCACACTGATGCAGG - Intergenic
1196007091 X:110848643-110848665 CTACAAATGCAGGCGCATGCAGG + Intergenic
1200787363 Y:7272718-7272740 CACAAAATGCAGGTGGAGGCTGG + Intergenic