ID: 963605595

View in Genome Browser
Species Human (GRCh38)
Location 3:147409918-147409940
Sequence CGGCGCGCCCGGGCGCTGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 258}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963605595_963605604 9 Left 963605595 3:147409918-147409940 CCGGCCAGCGCCCGGGCGCGCCG 0: 1
1: 0
2: 2
3: 25
4: 258
Right 963605604 3:147409950-147409972 CTGCAGGCTAGGACTTCGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 44
963605595_963605601 -2 Left 963605595 3:147409918-147409940 CCGGCCAGCGCCCGGGCGCGCCG 0: 1
1: 0
2: 2
3: 25
4: 258
Right 963605601 3:147409939-147409961 CGCGCCATTGCCTGCAGGCTAGG 0: 1
1: 0
2: 2
3: 30
4: 321
963605595_963605599 -7 Left 963605595 3:147409918-147409940 CCGGCCAGCGCCCGGGCGCGCCG 0: 1
1: 0
2: 2
3: 25
4: 258
Right 963605599 3:147409934-147409956 CGCGCCGCGCCATTGCCTGCAGG 0: 1
1: 0
2: 1
3: 6
4: 75
963605595_963605605 12 Left 963605595 3:147409918-147409940 CCGGCCAGCGCCCGGGCGCGCCG 0: 1
1: 0
2: 2
3: 25
4: 258
Right 963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 64
963605595_963605606 13 Left 963605595 3:147409918-147409940 CCGGCCAGCGCCCGGGCGCGCCG 0: 1
1: 0
2: 2
3: 25
4: 258
Right 963605606 3:147409954-147409976 AGGCTAGGACTTCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963605595 Original CRISPR CGGCGCGCCCGGGCGCTGGC CGG (reversed) Exonic
900314444 1:2050116-2050138 CGGCGCCCCCGGGAACTCGCTGG - Intergenic
900344865 1:2205738-2205760 TGGCGCGCCCGGGGACTGGAAGG + Intronic
900349667 1:2228492-2228514 CGGGGGGCCCGGGCGGCGGCGGG + Intergenic
900349683 1:2228540-2228562 CGCCGGGCCCGGGCGGCGGCGGG + Intergenic
901060894 1:6471461-6471483 GGGCGGGGCCGGGCGCAGGCGGG - Intronic
901242789 1:7704702-7704724 CGGCGCACTCGGGCAGTGGCGGG + Intronic
902350013 1:15847586-15847608 CCGCGCGCCTGCGCGCCGGCTGG + Intergenic
902501463 1:16914200-16914222 CCGCGCGCCTGGGGGCGGGCTGG + Intronic
903034532 1:20485657-20485679 CGGCGCGCTGGGGCTCTGGGCGG + Exonic
903326367 1:22571036-22571058 GGGCACGCCTGGGCCCTGGCTGG + Intronic
904563391 1:31413318-31413340 CGGCGCGCGCGGGCGGGCGCCGG - Intronic
907079460 1:51608020-51608042 CGGCCCGCCCAAGTGCTGGCAGG - Intronic
908796094 1:67832938-67832960 CGGGGCGCACGGCCGCAGGCTGG + Intronic
910825627 1:91404548-91404570 CGGCGCGCTCGGGCGCAGGGCGG - Intronic
913130818 1:115837735-115837757 TGGCGAGCCCGGGGGCTCGCAGG - Exonic
915446818 1:155978741-155978763 GGGCGCCCCCAGGCGCTGGAGGG - Intronic
917920299 1:179744448-179744470 CCGCGCGCCGGGGCCCTGGGTGG + Intronic
920218371 1:204377695-204377717 CTGCGCCCCCAGGCGCCGGCTGG + Intergenic
920260632 1:204685569-204685591 CGTCGCGGCCGGAGGCTGGCGGG + Intronic
922648825 1:227318812-227318834 CGGCGGGACTGGGCGCAGGCTGG + Intergenic
922958560 1:229625819-229625841 AGGCGCGCGCGCGCGCGGGCGGG - Intronic
923506447 1:234609748-234609770 CGGCCGGCCCGGGCACGGGCGGG + Intergenic
924090101 1:240492919-240492941 GCGCGCGCCCGGCCGCTGGGTGG - Exonic
924466494 1:244303455-244303477 CGGCCCTCCCAGGTGCTGGCAGG + Intergenic
1064393237 10:14959483-14959505 GGGGGCGCCCGGGAGCTTGCAGG - Exonic
1065099510 10:22320584-22320606 GGGCGCGCGCGGGCGACGGCTGG - Intronic
1065099535 10:22320638-22320660 CGGCGCGGCCGCGGGCTGGCGGG + Intronic
1065102164 10:22341259-22341281 CGGCTCTCCTGGGCGCTGGCAGG - Intergenic
1065883857 10:30059605-30059627 GGGCGGGCCCGGGCGGTGGGCGG - Intronic
1070835690 10:79445632-79445654 CGGCGCGCGCAGGCGGTGGAAGG + Intergenic
1071997675 10:91163316-91163338 CGGCGGGGCCGGGCGCCGGGCGG + Intronic
1073812385 10:107164776-107164798 GAGCGGGCGCGGGCGCTGGCGGG + Intergenic
1074503449 10:114045392-114045414 AGGCGGCCCCGGGCGATGGCGGG - Exonic
1074618693 10:115094213-115094235 CGGGGCGCCCCGGGGCTGGAGGG - Intronic
1074829880 10:117241007-117241029 CGGCGCGGGCGGGCGGAGGCCGG + Intergenic
1075801848 10:125159410-125159432 CGGCGGGCGCGGGCGGGGGCCGG - Intronic
1076714373 10:132355890-132355912 CGGCACGCGCGGGCGGTGACCGG + Intronic
1077065536 11:639559-639581 GGGGGCGCCGGGGCGCGGGCGGG - Intronic
1077090822 11:777503-777525 GGGCGCGCCCGGGAGTTCGCGGG + Intergenic
1077090859 11:777617-777639 CCGCGCGCCCGGGCGGTCGCAGG + Exonic
1077459323 11:2700740-2700762 GGGCCCGGCCGGGCGCTGGCAGG - Intronic
1077505718 11:2929225-2929247 GGGCGCGCGCGGGGGCTGGCGGG + Exonic
1077923023 11:6655624-6655646 CCGCGCGAGCGGGCGCTGCCCGG - Exonic
1078771748 11:14358560-14358582 CGCCGCGCCCGGGAGGAGGCAGG + Intronic
1079035293 11:17014700-17014722 CGGCGCGGGGGGCCGCTGGCGGG + Intergenic
1079308763 11:19346435-19346457 CGGCGGGCTAGGGCGCGGGCGGG + Intergenic
1083048217 11:59755262-59755284 CCGGGCGGCCGGGCGGTGGCGGG + Exonic
1083728881 11:64642745-64642767 CGCCGCCCCCCGGCCCTGGCTGG - Intronic
1083920999 11:65781308-65781330 CGGTGTGCCCGGGCGCCGGCGGG - Intergenic
1084363636 11:68684489-68684511 CGGCGCACCCGGGAGCCGCCCGG - Exonic
1084588763 11:70078471-70078493 CGGCGGGCCTGGGCGCGGGGAGG + Exonic
1084787074 11:71448584-71448606 CGGCCCGCCCGGGCCCTAGTGGG + Intronic
1085332963 11:75668241-75668263 CGGGGCGCCCGGGTGCTCGGTGG + Exonic
1087076246 11:94129217-94129239 CCGCGCGCCCGGCCGGTGACTGG + Exonic
1090211060 11:124921335-124921357 CGCCGTGCCCGGCCGCTCGCCGG - Exonic
1090238278 11:125165130-125165152 CGGCGGGGCTGAGCGCTGGCCGG - Intronic
1095206119 12:39442738-39442760 ACGCGCGGCCGGGTGCTGGCAGG - Intronic
1095703656 12:45216167-45216189 CGGCTTTCCCCGGCGCTGGCTGG + Exonic
1096086037 12:48865620-48865642 CTGCCCGCCCGCCCGCTGGCCGG - Intronic
1096116809 12:49059955-49059977 CGGGCGGCCGGGGCGCTGGCCGG - Intergenic
1097267786 12:57755715-57755737 CCGCGGGCCCGGGGCCTGGCCGG + Exonic
1099890132 12:88580234-88580256 GGGCGCGCCCGGGAGCTCCCAGG - Intronic
1099989556 12:89708556-89708578 CGCCGCCCCCGGCCGCGGGCGGG + Intronic
1103074259 12:117969298-117969320 CGCCGCCCCCGGGAGCAGGCTGG - Intergenic
1103322627 12:120100861-120100883 CGGCGCGCCCTCGCTCTGGAAGG - Intronic
1104694353 12:130852183-130852205 CACCGCGCCCGGCCGCTGTCAGG - Intergenic
1106776711 13:33016444-33016466 CGGCGCGGCGGGGCGCTGGCGGG - Exonic
1108478440 13:50843448-50843470 CCTCGCGCCCGGGCCCCGGCCGG + Exonic
1108542071 13:51453635-51453657 CGGCGCGAGCGGGCGCGGGCGGG + Intronic
1112012042 13:95301029-95301051 CCGCGCCCCGGGGCGCAGGCAGG + Intronic
1113820661 13:113209882-113209904 GGGGGCGCCGGGGCGCCGGCCGG + Intronic
1113948156 13:114056486-114056508 CGGCGTCCCTGGGCGCTGCCCGG + Intronic
1113985694 13:114314268-114314290 AGCCGCGCCCGGGCGCGCGCGGG + Intergenic
1115851196 14:37591812-37591834 CGGCGCGCCCTCTAGCTGGCCGG + Exonic
1121754637 14:96392343-96392365 CTGCGCCCCAGGGCGCTGTCGGG + Intronic
1122220857 14:100238640-100238662 CGGCTCGCACGCGCCCTGGCTGG - Intronic
1122275231 14:100587492-100587514 CGCCCCGGCCGGGCGCTGCCGGG - Intergenic
1122917323 14:104865189-104865211 CGGCGCGGCCGGGCGGGGGCGGG + Intergenic
1122975436 14:105168904-105168926 CGCCGGGCCGGGGCGCTGGCAGG - Intergenic
1123174126 14:106401333-106401355 CGGGACGCGCGGGGGCTGGCGGG - Intergenic
1123182335 14:106482267-106482289 CGGGACGCGCGGGGGCTGGCGGG - Intergenic
1202944568 14_KI270726v1_random:14463-14485 CGGGACGCGCGGGGGCTGGCGGG + Intergenic
1123880703 15:24675915-24675937 CGCCACGCCCTGGCCCTGGCAGG - Exonic
1124439272 15:29675004-29675026 AGGCGCGCCCAGGCCCCGGCGGG - Intergenic
1124500794 15:30225244-30225266 CGCGGTGCCCGGGGGCTGGCGGG - Intergenic
1124742776 15:32313423-32313445 CGCGGTGCCCGGGGGCTGGCGGG + Intergenic
1125500618 15:40238566-40238588 TGGCGCTCCGGGGAGCTGGCAGG + Intergenic
1126767046 15:52019594-52019616 CGGCGCGTCCCCGCGCGGGCGGG + Intronic
1129220795 15:74130585-74130607 CGAAGCTCGCGGGCGCTGGCGGG + Exonic
1129330876 15:74826546-74826568 GGGCGGGCCCGGGCGGGGGCGGG + Exonic
1129761488 15:78131471-78131493 CAGCGCGCCCGGGTCCCGGCAGG + Exonic
1132527717 16:425898-425920 CGGCGCGGGCGGGCGCGCGCGGG - Exonic
1132560220 16:590118-590140 AGGTGCGCCCGGGCGCGGGCGGG + Intronic
1132580224 16:681242-681264 CGGCGCGCCCTGGAGCTGGACGG + Exonic
1132580873 16:684140-684162 CGGCCCGCCCGGGCGCCTGCGGG + Exonic
1132625192 16:888219-888241 CTGCCCGCCCAGGCCCTGGCAGG + Intronic
1132663779 16:1072745-1072767 CCGGGCTCCCGGGCGCCGGCTGG - Intergenic
1133029711 16:3004585-3004607 CGGAGCGCGCGGGCGCGGGCAGG - Intergenic
1133220088 16:4316095-4316117 CGGAGCGGCCGGGCGCCGGGCGG + Intronic
1133286669 16:4693912-4693934 CGGCGCGGGCGGGCCCGGGCGGG + Intronic
1135040523 16:19114165-19114187 CGGCGCGCGGGGGCGCCGGGCGG + Intronic
1136399873 16:30011443-30011465 CCGCGCGCGCGGGCGGGGGCGGG - Intronic
1136627800 16:31472458-31472480 CCCCGCGCCCGGGCGCCCGCGGG - Intronic
1138651665 16:58464399-58464421 CGGCGCGGCCCGGCTCTGGGTGG - Exonic
1139545408 16:67647521-67647543 CGACTGGCCCAGGCGCTGGCGGG + Exonic
1140481706 16:75265843-75265865 CGCCGCCCCCGGGGCCTGGCGGG + Exonic
1141620850 16:85235883-85235905 CGCCCCGCCCCCGCGCTGGCCGG + Intergenic
1141727470 16:85799406-85799428 TGGCGCGGCCGCGGGCTGGCGGG + Exonic
1142395339 16:89828545-89828567 CTGCCCGCCCGGGCCATGGCGGG - Exonic
1142670671 17:1486079-1486101 CGGCGGGCCTGGGCGCTGGGCGG + Intronic
1142757514 17:2024779-2024801 CCGCGAGCCCGGGCGCCGCCCGG - Intronic
1144269218 17:13601205-13601227 CGGCGGGCCAGCGCGCTGGACGG + Exonic
1145269277 17:21396084-21396106 CTGGGCCCCCGGGCGCAGGCAGG + Intronic
1146009268 17:29180494-29180516 CGGCGCGCACTGGCGCTGCCAGG - Intergenic
1147636484 17:41967263-41967285 CCCCGCGCCCGGGTGCGGGCGGG + Intronic
1148553423 17:48564171-48564193 CGGGGCGCTCGGGGCCTGGCGGG - Intronic
1148905445 17:50909165-50909187 CGGCGCTCCTGGAGGCTGGCTGG + Intergenic
1151705566 17:75765238-75765260 CGGGGCGTCCGGGCGCGGGGCGG - Exonic
1151783943 17:76265978-76266000 CGGCGGGCAGGGGCGCGGGCCGG + Intronic
1152396362 17:80035913-80035935 GGGCGGGCCCGGGGGCGGGCCGG - Intergenic
1152728915 17:81960530-81960552 CGACGCGCCCGGTCTCCGGCTGG - Intronic
1153794650 18:8610326-8610348 CGGCGCGCGCTGGCCTTGGCGGG - Intronic
1154241499 18:12657755-12657777 CGGCGCGGCCGGGGGCTCCCGGG - Exonic
1155007338 18:21741032-21741054 CTGAGGGCCCGGGCGCTCGCCGG + Intronic
1156036599 18:32772085-32772107 CGGCGGGCCGGCGCGCGGGCGGG - Exonic
1156149189 18:34223257-34223279 CCCCGCGCTCGGCCGCTGGCCGG + Exonic
1157248240 18:46072027-46072049 CCGCGCGCCCGGGGGCTTGGCGG - Intronic
1157662756 18:49460278-49460300 CGCCGCCCCGGGGCGCTGGCCGG + Intronic
1160256205 18:77250510-77250532 CCGCGCGCCCCGCCGCTCGCCGG + Intergenic
1160567832 18:79798147-79798169 CGGTGCGCGCGGGCGCGGGAGGG + Intergenic
1160619334 18:80159945-80159967 GGGCGCGCCCGGGGTCTGGGGGG + Exonic
1160703630 19:519252-519274 CGCCGCGCCCGCGCGCTTCCTGG + Exonic
1160725446 19:616154-616176 CGCGGTGCCCGGGGGCTGGCGGG - Exonic
1160766823 19:812545-812567 CGGCGGGGCCGGGGGCGGGCGGG - Exonic
1160790253 19:919767-919789 CGGGGCGCCCGGGCCTTTGCAGG + Intronic
1160913099 19:1483812-1483834 CGGCGGGGCCGGGCGGGGGCGGG - Intronic
1160937815 19:1605478-1605500 CGGCGCGCACGCGCGCGGGGAGG + Exonic
1163708543 19:18832061-18832083 CCGCGCGCCCCGGCGCCAGCCGG - Exonic
1164713435 19:30375266-30375288 CGCGGGGCCCGGGCGCGGGCAGG - Intronic
1165129197 19:33621794-33621816 CGGCCCTCCCGGGGGCTCGCGGG - Intergenic
1165993058 19:39826912-39826934 GGGCGGGCCCGGGGGCCGGCGGG - Exonic
1166046003 19:40231676-40231698 CTGCATGGCCGGGCGCTGGCCGG - Exonic
1166759552 19:45216041-45216063 CGGCGAGCCCTGGCCCAGGCGGG + Intronic
1166898579 19:46040375-46040397 CCCCGCACCTGGGCGCTGGCTGG + Exonic
1166986214 19:46661142-46661164 CTGCCCGCCCGCCCGCTGGCCGG + Intergenic
1167048908 19:47067178-47067200 GGAGGCGCCCGGGCGCTGCCGGG + Exonic
1167627836 19:50604303-50604325 CGGCGGGTCCGCGGGCTGGCGGG + Intergenic
1167628193 19:50606198-50606220 CGGCGGGCCCGCGGGCTGGCGGG + Intergenic
1168305527 19:55433234-55433256 CAGCGTGCCCTGGCGCTGGAAGG + Exonic
927811747 2:26184383-26184405 GGCCGGGCCGGGGCGCTGGCCGG + Exonic
927881461 2:26692727-26692749 CGGCGGCCCCGGGCGCTGAGCGG + Intronic
928278067 2:29920564-29920586 TGGGGAGCCCGCGCGCTGGCCGG + Exonic
929776644 2:44934626-44934648 AGGCGCGCGCGCGCGCTTGCGGG - Intergenic
933893216 2:86789640-86789662 CTGCGCCCCCCGCCGCTGGCCGG + Exonic
935112421 2:100105149-100105171 GGGCGGGGCCGGGCGCGGGCGGG - Intronic
935692575 2:105744752-105744774 CCGCGCGCCCGGGCCTGGGCCGG + Intergenic
936433242 2:112482173-112482195 CGCCGCGCCCGGGCGCCCGCCGG - Exonic
936512202 2:113157459-113157481 CCCCGCGCCCAGGCGCCGGCTGG - Intronic
937221744 2:120346066-120346088 GGGCGGGCGCGGGCGCGGGCGGG + Intergenic
938835216 2:135095334-135095356 CACCGCGCCCGGCCGCAGGCAGG + Intronic
938875937 2:135531577-135531599 CGGCGCGGCGGGGCGACGGCGGG - Intronic
942178258 2:173355275-173355297 CAGCGCTCCCGGCCGCTGTCCGG - Intronic
942463826 2:176188461-176188483 CGTCGCGACCGGGGGCTGCCTGG - Intergenic
942505473 2:176637727-176637749 CGACGCGCGAGGGCGCGGGCGGG - Intergenic
944766706 2:202871684-202871706 CGGGGCTCGCGGGCGGTGGCCGG - Intronic
945032907 2:205682149-205682171 CGGCGCGCCCTGGGGGTGCCCGG + Intronic
945119630 2:206443966-206443988 GTGCGGGCCGGGGCGCTGGCAGG - Exonic
947612019 2:231530453-231530475 CGGGGCGTCGGGGCGCGGGCTGG - Exonic
948438062 2:237967207-237967229 CGGAGGGCGCGGGCGGTGGCGGG + Intronic
948459088 2:238120566-238120588 GGGGGCGCCCAGGCGCGGGCAGG - Intronic
948467494 2:238159232-238159254 CGGGGCGTGCGGGCGCGGGCTGG - Intronic
1168804421 20:664146-664168 GGGCGCGCGGGGGCGCAGGCGGG - Exonic
1168991711 20:2101900-2101922 CCGCTGGCCCGGGCGCCGGCGGG + Exonic
1169488393 20:6052336-6052358 CTCCGCGCCCTGGCGCTCGCCGG - Exonic
1170558006 20:17531087-17531109 CAGCTCGCCCAGGCGCTGGAAGG + Exonic
1171444820 20:25195873-25195895 CGGCGGGCCGGGGCGCTGGCGGG + Intronic
1172118529 20:32584905-32584927 CGGCGCCCTCGGGGGCGGGCCGG + Intronic
1172702945 20:36863727-36863749 CGGCGGGGCGGGGAGCTGGCGGG - Intergenic
1173279980 20:41618789-41618811 TGGCGCGCTCGGGCGCCGGCGGG + Intergenic
1175074017 20:56358867-56358889 CGCCGCGCGCGCGCGCTGGGCGG - Intergenic
1175199178 20:57266329-57266351 CGGTGCGCCCGGGCGAGTGCGGG - Exonic
1178922501 21:36747842-36747864 CGGCGCGCCCGGGGCCTCGGGGG - Exonic
1179980063 21:44891164-44891186 CGGCCTGCCCGGGGGCTGGATGG - Intronic
1180110190 21:45643831-45643853 CGGCGAGCCCGCGGGCCGGCGGG - Exonic
1180650215 22:17370304-17370326 CGGCGGGGCCGGGCGCGGGGGGG + Intronic
1181283519 22:21736129-21736151 CGCCGCGCTCGGACGCAGGCTGG + Intergenic
1181522809 22:23459231-23459253 CTGCGCGCCCGGGCGTGTGCTGG + Intergenic
1181811372 22:25405493-25405515 GGGCCCGCCCGGCCGCCGGCCGG - Intergenic
1181813677 22:25421038-25421060 CGGCGCGCCGCGACCCTGGCGGG + Intergenic
1182226202 22:28800561-28800583 CGGCGAGGCTGGGCGCTGGGCGG - Exonic
1184027325 22:41867516-41867538 CACCGCGCCCGGCCGCTTGCTGG - Intronic
1184127762 22:42500282-42500304 GGGCCCGCCGGGGCTCTGGCAGG + Intergenic
1184241295 22:43212500-43212522 CGGTGCGCCCGGGCTCAGGCTGG + Exonic
1184264084 22:43337506-43337528 CGGCTGGCCCGGCTGCTGGCAGG - Intronic
950345323 3:12287844-12287866 GGGCGGGCGCGGGCGCCGGCTGG - Intronic
951543625 3:23806110-23806132 CGGCGCGGCCGGGGGGCGGCGGG - Intronic
951558861 3:23946031-23946053 GCGCGCGCGCGCGCGCTGGCTGG + Intronic
954249683 3:49358198-49358220 CGGCGCGCCCGCTGGCCGGCGGG - Exonic
955818689 3:62874425-62874447 GGGCGAGCCCGGCCGCTGGGAGG + Intronic
959359078 3:105367318-105367340 CGCGGTGCCCGCGCGCTGGCGGG - Exonic
963605595 3:147409918-147409940 CGGCGCGCCCGGGCGCTGGCCGG - Exonic
966886666 3:184380810-184380832 CGGCCGGCCCGGGCCCTGGCGGG + Intronic
968472025 4:786730-786752 CGGCCCGCCCGGGAGCCGCCGGG - Intronic
968729253 4:2261984-2262006 CGGGGCGGACGGGCGCGGGCGGG - Exonic
968775236 4:2536380-2536402 CCGAGGGCCCGGGCGCTGGGAGG - Intronic
969605564 4:8200634-8200656 CGGCGCACCCGTGCGCTGCTGGG - Intronic
969716886 4:8872038-8872060 GGGCGGCCCCGGGCGCAGGCGGG + Intergenic
971351909 4:25862911-25862933 CGGCCCGGCCGGGGGCGGGCGGG - Exonic
972245674 4:37243983-37244005 CGACGGGCCCGGGAGCTGTCAGG + Intergenic
973110314 4:46390090-46390112 CGGTGCGCGCCGGCGGTGGCGGG + Intronic
976266142 4:83186871-83186893 CGGCGCGCGCAGGCACTCGCAGG + Intergenic
978351507 4:107824979-107825001 CGGCGCGCACGGAGCCTGGCCGG + Intronic
979624102 4:122827022-122827044 GGGCGCGGCCGCGCGCTGCCGGG + Exonic
980730107 4:136812732-136812754 CTGCACTCCCGGGTGCTGGCAGG - Intergenic
980990679 4:139735832-139735854 AGGCGGTCCCGGGCGCGGGCAGG + Intronic
981550543 4:145937561-145937583 GGGCGCGCCGGGGCGCGGGGCGG - Intronic
983940221 4:173529393-173529415 CCGGGCGCCCGGGGGCTGGGGGG - Exonic
984639272 4:182144539-182144561 CCGCGCGGCCGGGGGCGGGCAGG + Intronic
984888745 4:184473519-184473541 GGGCCCGACCGGGCGCTGGCCGG + Intronic
985662690 5:1165219-1165241 CTGCGGGCCCGGGGACTGGCAGG + Intergenic
985699018 5:1359191-1359213 CGGGGCACCCGGGGGCAGGCAGG - Intergenic
985761903 5:1753219-1753241 CGGAGCGCTCAGGCTCTGGCCGG - Intergenic
986608431 5:9545504-9545526 CGCCGCGCCGCGCCGCTGGCCGG - Intronic
987099790 5:14581801-14581823 AAGCGAGCCCGGGCGCCGGCGGG + Exonic
987340446 5:16935471-16935493 GCGCGCGCCGGGGCGCGGGCGGG - Intronic
988577990 5:32444816-32444838 CGGCTCCCCCGGGCGCGTGCCGG + Intergenic
989229913 5:39074225-39074247 GAGCGAGCCGGGGCGCTGGCCGG - Intronic
992487593 5:77210879-77210901 CGGCGGCCGCGGGCGCGGGCGGG + Exonic
999129444 5:149271793-149271815 GGGCGGGCGCGGGCGCGGGCGGG + Intergenic
1000071405 5:157743957-157743979 CGGCGGGCGCGGGCGCGGGCGGG + Exonic
1002401675 5:178994663-178994685 CCGCGCGCCCAGGCGCACGCCGG + Exonic
1002897891 6:1389842-1389864 CGGCGGGCTAGGGCGCTCGCAGG + Exonic
1006725541 6:36196921-36196943 CGGGGCCCCTGGGCGCGGGCGGG - Exonic
1007902064 6:45422095-45422117 CGGCGCGGCGCGGCGGTGGCGGG + Intronic
1011590057 6:88963345-88963367 CGGCGCGGCCAGCCGGTGGCAGG - Exonic
1013619342 6:111873055-111873077 CGGCGGGCCCGGGAGCCGGTGGG + Exonic
1018876519 6:167826849-167826871 CGGCGCGCACGGCGGCGGGCGGG + Intergenic
1018957707 6:168421498-168421520 CGGCTGGCCAGGGCGCTGGGGGG - Intergenic
1019343823 7:520270-520292 CGGAGCGCCGGGGCGGGGGCGGG - Intronic
1019424461 7:967601-967623 CGGAGCTCCCGGGCCCAGGCCGG - Exonic
1019428780 7:989050-989072 AGGCGCTCCTGGGGGCTGGCAGG - Exonic
1019473397 7:1232966-1232988 CGGGGCGCGGGGGCGCGGGCCGG - Exonic
1019487913 7:1297735-1297757 CTGGGCGCCCGGGAGCGGGCAGG - Intergenic
1019588516 7:1817306-1817328 CTGCGCGCCCGGGCGGGTGCTGG - Intronic
1020212803 7:6168463-6168485 TGGCGAGCCAGGGCCCTGGCTGG - Intronic
1021717656 7:23474120-23474142 CGGTGCGTCCCCGCGCTGGCCGG - Intergenic
1022814947 7:33905029-33905051 GGGGGCGCCCGGGCGCAGGAGGG - Exonic
1024472125 7:49775274-49775296 CGGCGGGCCGGGGCGCGCGCGGG + Intronic
1025929443 7:65982332-65982354 GGGCGGGGCCGGGCGCTGCCCGG + Intergenic
1025990622 7:66494047-66494069 CGGCGTCCCCGGGACCTGGCTGG - Intergenic
1027421112 7:78019377-78019399 CGTCGCGCCGGGGCCCTGGAAGG - Exonic
1032095806 7:128938091-128938113 CGGCGCGCCCCGAGGGTGGCGGG + Intronic
1034257651 7:149733400-149733422 CGGCTCGCCACAGCGCTGGCAGG + Exonic
1035404251 7:158587818-158587840 GGGCGGGGCCGGGCGCTGTCCGG - Intergenic
1035580864 8:738322-738344 CTGCGCGCACGGGGGCTCGCGGG + Intergenic
1036562068 8:9906318-9906340 CGGCGCGCGTGGGCTCGGGCAGG - Intergenic
1037879341 8:22565488-22565510 GGGCCCTCCTGGGCGCTGGCGGG + Intronic
1039608517 8:38901489-38901511 AGGGGCGCGCGGGGGCTGGCGGG + Intronic
1041689804 8:60678370-60678392 CGCTGCGCCCGGGCGCGGACTGG - Intergenic
1043388267 8:79768375-79768397 CGGCGCGCCCTCGCGCGGCCCGG - Intergenic
1044719692 8:95133760-95133782 GGGCGCGCCCGTGCGCGCGCAGG + Intergenic
1045098930 8:98825861-98825883 CGGCGCGGCCGGGGGCGGGGCGG - Intronic
1046932483 8:119855575-119855597 CGGCGCCCCCAGCCTCTGGCCGG - Intronic
1049478051 8:142806011-142806033 CCCCGGGACCGGGCGCTGGCAGG - Intergenic
1053129091 9:35605337-35605359 CAGCGCTCCGGGGCGCCGGCGGG - Exonic
1054775638 9:69121642-69121664 CGGCTCTCCGGGGCGCTGGGCGG - Intronic
1057739261 9:97697440-97697462 TGGCCTGCCCGGGCGCTGGGCGG + Intergenic
1058019037 9:100068400-100068422 CGGCTGGCCCGGCGGCTGGCCGG - Intronic
1058413818 9:104764314-104764336 GGGCGCGCCCGAGCCCTGGCCGG + Intronic
1058432092 9:104928430-104928452 CGGCGGGCCCGGGCGGGGGAAGG - Intergenic
1060283333 9:122228279-122228301 CGGCGCGCCGAGGGGCTGGAGGG - Intronic
1061755912 9:132812554-132812576 CGCCGCGCCCGGCCGCTAGGTGG + Intronic
1061975746 9:134067455-134067477 CGGAGCGCACGGCCGCAGGCCGG + Intronic
1062022685 9:134326739-134326761 CGGCGCGCGCGGGGGGTCGCCGG + Intronic
1062278412 9:135741323-135741345 CGGCGTGGCCAGGCCCTGGCTGG - Intronic
1062529806 9:136994871-136994893 CGGCGCGCCTGGGGGACGGCAGG - Intronic
1062537405 9:137027073-137027095 GGTCCCGCCCGGGCCCTGGCTGG + Intronic
1186496451 X:10015544-10015566 CGGGGCGGCCGGGCGGCGGCGGG + Exonic
1186829846 X:13379266-13379288 CGGCGCGCCCGCTGGCCGGCGGG - Intergenic
1189318664 X:40074115-40074137 GGGCATGCCCGGGCACTGGCTGG + Exonic
1190008070 X:46758991-46759013 CGGCGCGCCCTGGCTCGGGTCGG - Exonic
1190303223 X:49068069-49068091 CGGCGCCCCCTGTCTCTGGCAGG + Exonic
1191875017 X:65787511-65787533 CACCGCGCCCGGCCGATGGCCGG + Intergenic
1195888972 X:109671394-109671416 CGCCCCGCCCGGGAGCTGGGGGG + Intronic
1199612663 X:149631484-149631506 CTGCGGGCTCGGGCGCGGGCTGG - Intronic
1200128891 X:153830591-153830613 CGGCGCGCCCCCGCGCTCCCTGG - Intergenic