ID: 963605596

View in Genome Browser
Species Human (GRCh38)
Location 3:147409922-147409944
Sequence GGCGCGGCGCGCCCGGGCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 770
Summary {0: 1, 1: 0, 2: 6, 3: 108, 4: 655}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963605596_963605605 8 Left 963605596 3:147409922-147409944 CCAGCGCCCGGGCGCGCCGCGCC 0: 1
1: 0
2: 6
3: 108
4: 655
Right 963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 64
963605596_963605601 -6 Left 963605596 3:147409922-147409944 CCAGCGCCCGGGCGCGCCGCGCC 0: 1
1: 0
2: 6
3: 108
4: 655
Right 963605601 3:147409939-147409961 CGCGCCATTGCCTGCAGGCTAGG 0: 1
1: 0
2: 2
3: 30
4: 321
963605596_963605604 5 Left 963605596 3:147409922-147409944 CCAGCGCCCGGGCGCGCCGCGCC 0: 1
1: 0
2: 6
3: 108
4: 655
Right 963605604 3:147409950-147409972 CTGCAGGCTAGGACTTCGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 44
963605596_963605606 9 Left 963605596 3:147409922-147409944 CCAGCGCCCGGGCGCGCCGCGCC 0: 1
1: 0
2: 6
3: 108
4: 655
Right 963605606 3:147409954-147409976 AGGCTAGGACTTCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963605596 Original CRISPR GGCGCGGCGCGCCCGGGCGC TGG (reversed) Exonic
900088700 1:910070-910092 TCCGCGGCGCGGCCGGGTGCTGG - Intergenic
900088736 1:910161-910183 GGCTCGGCGCGCGCGGGACCCGG + Intergenic
900100652 1:960751-960773 GGCGCCTCGGGCCCGGGCCCCGG - Exonic
900162831 1:1232426-1232448 GCGGCGGCGCGCGCGGGCGCGGG - Exonic
900162876 1:1232590-1232612 GGAGCGGCGCGCCCTGGAGCGGG + Exonic
900180240 1:1308040-1308062 CGGGCGGCGCGCGCGGGCGGCGG - Intronic
900190159 1:1349754-1349776 TGCGGGGCGCGCGGGGGCGCGGG + Intergenic
900221486 1:1511722-1511744 GGCTCGGCTTGCCCGGGCGCCGG + Intergenic
900344598 1:2204960-2204982 GGCGCGTGGCGCCCGGGGGGCGG - Intronic
900349665 1:2228488-2228510 CGCGCGGGGGGCCCGGGCGGCGG + Intergenic
900414700 1:2529584-2529606 GGCGCGGCGGGCGCGGCCGGGGG + Exonic
900513007 1:3069305-3069327 GGCGCGGCGCGGCCGAGCGCGGG - Intronic
900629296 1:3625166-3625188 GGCGGGGGGCGGCCGGGGGCGGG + Exonic
900786769 1:4654656-4654678 GGCGCGGTGGGCGCGGGCGGCGG + Intergenic
900787105 1:4655824-4655846 GGCGCGGCGGGCGCGGGGGCCGG + Intronic
901007924 1:6180543-6180565 GGCTTGGCGAGCCCGGGCGCAGG + Intergenic
901057624 1:6456015-6456037 GGCGCGGCGGGCGGGGGCGGCGG - Intronic
901577253 1:10210813-10210835 GCCGCGGCGCGCGGGGGCGCGGG - Exonic
901602144 1:10430667-10430689 CGCGGGGGGCGCCCGGGGGCGGG - Intronic
902072104 1:13749191-13749213 GGCGCGGCCCGCACGGGGCCGGG + Intronic
902336775 1:15758715-15758737 GGCGCGGGGCGGCGGGGCGGAGG + Intronic
902476732 1:16692453-16692475 GGCGCGGCGGGCCGGCGGGCGGG + Intergenic
902771278 1:18646875-18646897 GGCGCGGGGCGGCGCGGCGCGGG + Intronic
902771284 1:18646899-18646921 GGAGCGGCCCGCCCGCGCCCGGG + Intronic
902916924 1:19644811-19644833 GGCGCGGCGCGGCGAGGCCCGGG - Intronic
903153302 1:21428267-21428289 CGCGCCCCGCGCCCGGGCCCCGG + Intergenic
903349874 1:22711076-22711098 GGCGGGGAGCGGCCGGGCACGGG + Intronic
903468450 1:23568408-23568430 GCCGCGGCGGGGCCAGGCGCCGG + Intergenic
903738161 1:25543523-25543545 GGCGCGGCCCGTCTGGGGGCGGG + Intergenic
904528822 1:31155055-31155077 GGCGGGGAGCGGCCGGGCCCTGG + Intergenic
904620463 1:31772059-31772081 GGGGCCGCGCGGCCGGGAGCGGG + Intergenic
904642075 1:31938407-31938429 GGCGCGGCGCGCAGGGCCACCGG + Intronic
904744498 1:32702722-32702744 AGTGCGGCGGGCGCGGGCGCCGG - Exonic
904775046 1:32901326-32901348 GGTGCGGGGCGCGCGGGCGACGG - Exonic
904837670 1:33349672-33349694 GAGGCGGCCCGCCCGGGCCCGGG - Intronic
905075769 1:35269120-35269142 GGCGGGGCGCGGCCCGGGGCCGG + Intronic
905179152 1:36156008-36156030 GGCGCGGGGCTCCGGGGCGGGGG + Intronic
905179161 1:36156041-36156063 GGCGCGGACGGCGCGGGCGCGGG + Intronic
905267225 1:36762895-36762917 GGAGCGGAGGGCCCGGGTGCAGG + Intergenic
905685001 1:39901705-39901727 GGCCCGGCGGGGCCGGGCGGGGG + Intronic
905789905 1:40784246-40784268 GGAGGGGCGCGCCCGGCGGCAGG - Exonic
906062592 1:42958355-42958377 GGCGCGGCGCCCCCGGAAGGAGG + Intronic
906532824 1:46533220-46533242 GCCGCGGCGGGCCCGGGCCAGGG - Intergenic
906640831 1:47439405-47439427 GGGGCAGCACCCCCGGGCGCCGG + Exonic
908796093 1:67832934-67832956 GGCGCGGGGCGCACGGCCGCAGG + Intronic
910759101 1:90718004-90718026 GGCCCGGCGCGGCGCGGCGCGGG - Intergenic
910825629 1:91404552-91404574 CCTGCGGCGCGCTCGGGCGCAGG - Intronic
911144806 1:94541825-94541847 GGAGCGGCGGGGGCGGGCGCCGG - Intergenic
911208626 1:95117579-95117601 GGCGAGTCGCGCGCGGGCGGCGG - Exonic
911219689 1:95234039-95234061 GGCGAGGCGAGTCCGGGCGAGGG - Intronic
911527594 1:99004924-99004946 AGCGCCGCCCGCCCCGGCGCGGG + Intronic
912381368 1:109249777-109249799 GCCGCGGGGCCCCCGGGCGCAGG + Intergenic
912793556 1:112675455-112675477 GGGGCTGCGAGCCCGAGCGCGGG + Intronic
912955566 1:114152662-114152684 GGCGTGTCGCGCCCTGGCGGCGG - Exonic
914753046 1:150548976-150548998 GGCGCGGCGCGGCGCGGCACAGG - Intergenic
915359429 1:155277386-155277408 TGCGCGGCGCCCCCTGGCGAGGG - Intronic
915429771 1:155857234-155857256 GGCGCGGCGCTCCGAGGCTCGGG - Exonic
917291581 1:173477190-173477212 GGCGGGGCGGGGCTGGGCGCGGG - Intergenic
918423508 1:184386861-184386883 GGCGCAGCGCGCTGGGGAGCGGG - Intergenic
919916869 1:202144378-202144400 GGCGCGGCGCGGGCGGGGACAGG + Intronic
919916878 1:202144413-202144435 GGCGCGGGGTCCCCGGGCGCGGG - Intronic
920260630 1:204685565-204685587 GGCGCGTCGCGGCCGGAGGCTGG + Intronic
920914872 1:210251627-210251649 AGCGCGGCGCGGCCCGGCGGGGG + Intergenic
921029695 1:211326748-211326770 GGAGGGGCGCGGGCGGGCGCAGG - Intronic
922775524 1:228212783-228212805 GGTGCGGGGCGCGCGGGCCCAGG + Intronic
922925161 1:229342230-229342252 GGCGGGGCGCACCGGGGTGCGGG + Exonic
922958562 1:229625823-229625845 CGCGAGGCGCGCGCGCGCGCGGG - Intronic
923055922 1:230425995-230426017 GGGGCGGCGGGCCGCGGCGCGGG - Intergenic
923506458 1:234609772-234609794 GGCGCGGCGCGGCGGGGCGGCGG + Intergenic
923744327 1:236686522-236686544 GGGGCGACACGCCTGGGCGCTGG - Exonic
924801438 1:247331750-247331772 GGCGGGGCGGGGCCGGCCGCGGG + Intronic
1063995087 10:11611515-11611537 GGCGCGGCGCGGCGCGGCGGCGG + Intronic
1065022209 10:21509964-21509986 GGCGCAGGGCGCGCGGGGGCCGG - Intergenic
1065099511 10:22320588-22320610 GGCGGGGCGCGCGCGGGCGACGG - Intronic
1065214847 10:23439407-23439429 GGCGCGGCGAGCCCCGGAGCGGG - Intergenic
1065712814 10:28533459-28533481 GGCGCGCCGGGCCCAGGTGCCGG + Exonic
1065883859 10:30059609-30059631 GGCGGGGCGGGCCCGGGCGGTGG - Intronic
1066464398 10:35640327-35640349 GGCGCGGCGGGCGCGGGCGCGGG - Exonic
1067071877 10:43138454-43138476 GCGGCGGCGCGCCCGGGGGTGGG + Intergenic
1067091245 10:43266739-43266761 GGCGCGGCGTGCGCGGGCCCGGG - Intronic
1067300208 10:45001062-45001084 GGCGGCGCGGGCCCGGGCGATGG + Intronic
1067694336 10:48524152-48524174 GCCGCGCCGCCCCGGGGCGCAGG - Intronic
1069651636 10:70053528-70053550 GGCGCGGAGCAGCCGGGCGGAGG + Intronic
1069664509 10:70145761-70145783 CGCGCGGCCCGCGGGGGCGCTGG - Exonic
1069709321 10:70478795-70478817 AGCGCGGCGCGCACGGGCCGGGG + Intergenic
1069738362 10:70672384-70672406 GGCGCCGGGCGCCCGGGGGCGGG - Intergenic
1069738375 10:70672417-70672439 GGCGGGGCGGGGCCGGGCGCGGG - Intergenic
1070800823 10:79243523-79243545 AGCGCGGAGCGAGCGGGCGCCGG + Intronic
1071086819 10:81875223-81875245 GCGGCGGCGGGCTCGGGCGCAGG - Intergenic
1071997673 10:91163312-91163334 GGCACGGCGGGGCCGGGCGCCGG + Intronic
1072070267 10:91908708-91908730 GGCGCGCCCCGTCCGGGCTCTGG + Exonic
1072731558 10:97850150-97850172 GGCGCCGCGGGCCCGGGCTCAGG - Intergenic
1073137736 10:101229060-101229082 CGCGCAGCGCGCCCCGGCTCCGG - Exonic
1073812383 10:107164772-107164794 GGCGGAGCGGGCGCGGGCGCTGG + Intergenic
1074618455 10:115093382-115093404 GGCGAGGCGGGGCCGCGCGCGGG + Intronic
1074814476 10:117134240-117134262 GGCCCGGCGGGCCCGGGACCTGG + Exonic
1075040710 10:119104594-119104616 GGCGCGGCGCGGCGGGGAGGAGG + Intronic
1075334213 10:121597403-121597425 GGCGAGGGGCGCCCAGGCACCGG + Intronic
1075492085 10:122880001-122880023 GGCCCGGCGCACCGTGGCGCAGG - Intergenic
1075498861 10:122954003-122954025 GGCCCGGCGCACCCTGGAGCAGG + Exonic
1075616096 10:123891761-123891783 AGAGCGGCGCGCTTGGGCGCGGG + Exonic
1076554113 10:131311229-131311251 GGCAGGGCGCGCCCAGGAGCAGG + Intronic
1076707022 10:132307753-132307775 GGCGGGGCGCGCGCGGCCGGGGG + Exonic
1076900467 10:133335293-133335315 GGCGCTGCGGGCCCTGGTGCGGG - Intronic
1076908277 10:133373778-133373800 GACACAGCGCGCCCAGGCGCAGG + Intergenic
1077008454 11:369730-369752 GGCGCGGGGCGGGCGGGGGCCGG + Intergenic
1077253779 11:1571863-1571885 GGCGGGGCGGGGGCGGGCGCCGG - Intronic
1077491502 11:2862922-2862944 GGGGCGGCGGGCGCGGGCCCGGG + Intergenic
1078246217 11:9574533-9574555 GGCGCCGCGGCCCCGGCCGCCGG - Intronic
1078334182 11:10450905-10450927 GGCGCGGCCTGGCCGGGCCCTGG + Exonic
1078594620 11:12675097-12675119 GGCGCGGCGCGGCCGGCCGGGGG - Intronic
1079251574 11:18791385-18791407 GGCGTGGCGGGGGCGGGCGCCGG + Intronic
1079362009 11:19777301-19777323 GGCGAGGCGACCGCGGGCGCCGG + Intronic
1081950197 11:47038129-47038151 GGGGCGGCTGGCCCGGGCGGGGG + Intronic
1082028770 11:47590296-47590318 GGCGCGGGCGGCCCGCGCGCAGG + Exonic
1083258117 11:61508880-61508902 GGGGCGGGGGGCCCGGGGGCCGG + Exonic
1083572681 11:63768703-63768725 TGCGCGGGGCCCCGGGGCGCGGG + Exonic
1083669745 11:64293001-64293023 CGCATGGCGCGCCCAGGCGCCGG - Exonic
1083921001 11:65781312-65781334 GGTGCGGTGTGCCCGGGCGCCGG - Intergenic
1083939978 11:65890606-65890628 GGCGGGGCGCGCGCCGGGGCGGG - Exonic
1083999581 11:66288913-66288935 GGCGCGGCGCGGCCGGCGGGGGG - Intronic
1084066134 11:66705361-66705383 GGCGCGGCGGGCCCGGCTGGAGG - Exonic
1084072354 11:66744703-66744725 GGCGGGGCGTGCGCGGGCGCAGG + Intronic
1084129102 11:67119558-67119580 GGCGCGGCGCGCCGGGATGGGGG - Intronic
1084171273 11:67401969-67401991 GGCGCGGCGGCCCGGGGGGCGGG + Intronic
1084228356 11:67731956-67731978 GGCGCGGCGCCCCCCTGCGATGG + Intergenic
1084484283 11:69438903-69438925 GGCCCAGTGCACCCGGGCGCTGG - Intergenic
1084517097 11:69642982-69643004 GGGGCGGCGCGACCTGGCGGCGG + Intronic
1085266819 11:75242196-75242218 TGAGCGGCGCCCCCGGGCTCGGG + Exonic
1085519525 11:77129961-77129983 AGCGGGGCGGGCCCGGGCCCGGG + Intronic
1086321034 11:85647954-85647976 GACGCGGCGTGGGCGGGCGCCGG - Intronic
1086361848 11:86068598-86068620 CGCGCGGGTCGCGCGGGCGCCGG + Intronic
1087175298 11:95090183-95090205 TGCTCGGCGCCGCCGGGCGCAGG - Exonic
1088823488 11:113475301-113475323 GGCGGGGCGGGGCCGGGCGCGGG + Exonic
1090013120 11:123062413-123062435 GGCGCAGCGAGTCCGCGCGCGGG + Intronic
1090029729 11:123196158-123196180 GGGCCTGCGCGCCCGGGCTCCGG + Intergenic
1090202154 11:124864837-124864859 GGAGCGGCGCGCCCTGACCCGGG - Intergenic
1090616734 11:128522144-128522166 GGCGCGCACCGTCCGGGCGCGGG - Intronic
1090817956 11:130314965-130314987 GGCGGAGCGCGCTCGGGGGCGGG + Intergenic
1091226010 11:133956800-133956822 CGCGAGGCGCGTGCGGGCGCGGG - Exonic
1091381812 12:66818-66840 GGCGGGGAGCGCGAGGGCGCGGG - Exonic
1091550238 12:1530832-1530854 GGCGCGGCCCGCGGGGGCGCAGG - Intronic
1091684192 12:2550041-2550063 GGCACGGCGAGCCCAGGGGCTGG + Intronic
1092045948 12:5431993-5432015 GGCGCGGCGCGGGCCGGCGGGGG + Intergenic
1092246744 12:6868054-6868076 GGCGCGGGAGGCCAGGGCGCAGG - Intronic
1094485999 12:30926576-30926598 GGGGCGTCGCGGCCGAGCGCTGG + Intronic
1094753350 12:33439097-33439119 GGCGCGGCGAGGCTGGGAGCGGG + Intronic
1095703677 12:45216238-45216260 GGCGCGGCTCTCCCAGGGGCCGG - Exonic
1096116810 12:49059959-49059981 GGCGCGGGCGGCCGGGGCGCTGG - Intergenic
1096459417 12:51814185-51814207 GGCGCTGGGCACCGGGGCGCTGG - Intergenic
1097165989 12:57087181-57087203 GGCGCGGGGCGCCCGGGTCCCGG - Intronic
1097850250 12:64404414-64404436 GGTGCCGCGCGGGCGGGCGCCGG - Exonic
1097891323 12:64780680-64780702 GGCGCGGCGCCAGCGGGCTCTGG - Intergenic
1097981514 12:65741641-65741663 GGCGGGGCGGGGCCGGGCGGCGG + Intergenic
1098029011 12:66235299-66235321 GCGGCGGCGGGCGCGGGCGCGGG + Intronic
1101371964 12:104138345-104138367 GGCGGGGCGGGGCCGGGGGCGGG - Intergenic
1102644622 12:114396138-114396160 GGCGAGCCGCGGCCGGGGGCGGG + Intronic
1103348350 12:120265754-120265776 CGCGCGGCGGGCGCGGGCGCGGG - Exonic
1103363857 12:120368909-120368931 AGCGCCGGGCGCCAGGGCGCAGG + Intronic
1103400613 12:120640797-120640819 GGCGCGGTGCGGCGCGGCGCGGG - Exonic
1103433062 12:120904234-120904256 GGAGCGCCGCGCTCGGGCGGCGG + Exonic
1103509936 12:121467286-121467308 GGCTCGGCTCGCCCTGGCTCGGG + Intronic
1103649682 12:122422771-122422793 GGCGGCGCGGGGCCGGGCGCGGG - Intergenic
1103691029 12:122774556-122774578 GGCGCGGGGCCCCGGGGCTCCGG + Exonic
1103779487 12:123389367-123389389 GGCGCGGCGGGGCGGGGAGCGGG - Intronic
1103786466 12:123436595-123436617 GGGACGGTGCGCCGGGGCGCAGG - Exonic
1103800317 12:123533626-123533648 CGGGCGGCGGGCGCGGGCGCGGG + Exonic
1104568338 12:129904053-129904075 GGCCCGCCTCCCCCGGGCGCAGG - Intergenic
1104713806 12:131003948-131003970 GGAGCCGCGCGCCCGTGGGCCGG + Intronic
1105413904 13:20193031-20193053 GGCGGAGCGCGCCCGGCCTCTGG + Intergenic
1105578018 13:21670946-21670968 GGTGCGGCGCGCCAGAGCGCAGG - Intergenic
1105943407 13:25170687-25170709 GGCGCGCCGAGCCGGGGCCCGGG - Exonic
1106776713 13:33016448-33016470 CGGGCGGCGCGGCGGGGCGCTGG - Exonic
1108408409 13:50125786-50125808 GGCGCGGAGCCCCGGGGAGCTGG - Intronic
1108518189 13:51222286-51222308 GGCGGGGCGGGCGCGGGCGCAGG + Intergenic
1108542066 13:51453631-51453653 GCCCCGGCGCGAGCGGGCGCGGG + Intronic
1112012040 13:95301025-95301047 TGCGCCGCGCCCCGGGGCGCAGG + Intronic
1112402199 13:99086713-99086735 GGGGCGGGGCGCCCGGACGGCGG + Intergenic
1112506739 13:99980476-99980498 ACCGCGGCGCTCCCGGGAGCCGG - Intergenic
1113082636 13:106534791-106534813 GGCGCGGCGGACCCCGGGGCGGG + Intronic
1113379106 13:109786726-109786748 GGCGCGGCGCTCGCGGGGGCGGG + Intergenic
1113806164 13:113110857-113110879 GGCGCGGGGCGCCCCGAGGCTGG - Intronic
1114482195 14:23042827-23042849 GGCGCAGCGAGCCAGGGCGTAGG - Exonic
1115576140 14:34714317-34714339 GGCGGGGAGGGCCCGGGCGTCGG - Intronic
1115752923 14:36508382-36508404 GGCGGGGCGGGGCGGGGCGCGGG + Intronic
1118206492 14:63728085-63728107 GGCGCGGCGCGCGCGGGGCGGGG - Intergenic
1118776822 14:68978736-68978758 GGCCCGGCGTTCCCGGGCTCCGG + Intronic
1118776950 14:68979182-68979204 GCCGCGGCGGAACCGGGCGCAGG - Exonic
1119003845 14:70907360-70907382 GGCGCGGCGCGCACCGTAGCCGG + Intergenic
1119701980 14:76761797-76761819 GGCGCGGCCCGGGCGGGCGGAGG - Intergenic
1120993462 14:90397845-90397867 GGCGCGGCGCGGGCGTGGGCTGG + Intronic
1121050373 14:90816090-90816112 CCCGAGGCGCGGCCGGGCGCGGG - Intronic
1121226179 14:92323403-92323425 GGCGCGGCGGCGCGGGGCGCGGG + Intronic
1121648169 14:95535177-95535199 CGGGCGGCGGGCTCGGGCGCGGG + Exonic
1122131229 14:99605230-99605252 GGCTCGGCGCCCCCGGACCCCGG - Intergenic
1122162447 14:99793814-99793836 CGCGGAGCGCGCCCGGGCGGAGG + Intronic
1122444939 14:101761565-101761587 AGCGGGGCGGGGCCGGGCGCGGG + Intergenic
1122707267 14:103629167-103629189 GGCGGGGCGAGGCGGGGCGCCGG + Intronic
1122917321 14:104865185-104865207 GGTGCGGCGCGGCCGGGCGGGGG + Intergenic
1122947849 14:105021303-105021325 GGCGTGGCGGGGCCGGGCGCAGG - Intergenic
1122975437 14:105168908-105168930 CGCGCGCCGGGCCGGGGCGCTGG - Intergenic
1122982095 14:105196560-105196582 GGCTCGGGGCTCCCGGGGGCTGG - Intergenic
1123001955 14:105300631-105300653 GGCGCTGCCCGCGCGGTCGCCGG - Exonic
1123037766 14:105478372-105478394 TGCGCGGCGCGGGCGGGGGCGGG + Intronic
1124109257 15:26772257-26772279 GGAGCCGCGCTCCCAGGCGCCGG - Intronic
1124109525 15:26773146-26773168 GGAGGAGCGCGCGCGGGCGCGGG + Intronic
1126299983 15:47184547-47184569 GCCGCGGCGCGCCGGGAGGCTGG - Intronic
1127480341 15:59372062-59372084 GGCGGGGCGGGCACGGCCGCGGG + Intronic
1128264024 15:66252614-66252636 GGCTCGGCGCTCCCGGGCTCAGG + Intronic
1128547743 15:68579210-68579232 GGCGCGGCGTGCGGGGGCGGCGG - Exonic
1128605389 15:69033076-69033098 GGCGCGGCCGGCGCGGGCGTGGG - Exonic
1128812911 15:70585352-70585374 GGCGCGGCGCACCCGGGCAAAGG - Intergenic
1128865992 15:71115569-71115591 GGCGCGGGGCGGCTGGGCGGCGG + Intronic
1128999454 15:72320067-72320089 GGCGGGGCGGGCCCGGGCCGAGG + Exonic
1129274061 15:74433887-74433909 GGGGCGGCACGTCCGGGCGGAGG + Exonic
1129856914 15:78831134-78831156 GGCGGGGGCCGTCCGGGCGCCGG + Intronic
1130076492 15:80694978-80695000 GGCGCTGCGGGCAAGGGCGCGGG - Intronic
1130224530 15:82046875-82046897 AGCTCGGCCCGCCCGGCCGCTGG + Intergenic
1130564233 15:84980985-84981007 GGCGCCGCGCGCCGGGTCCCGGG - Intronic
1132099747 15:99014991-99015013 GGCTCGCCGCACCCCGGCGCCGG - Intergenic
1132419390 15:101652394-101652416 GGCGGGGCGCGCCTGGGAGCCGG + Intergenic
1132453297 15:101980240-101980262 GGCGCGGCGCGCCTTTGCGACGG + Intergenic
1132498657 16:275380-275402 GGTGAGGCGCGCCGGGGCGGGGG - Exonic
1132498862 16:275957-275979 GGCGCGGCGCGGCGCGGGGCGGG - Intronic
1132552779 16:560256-560278 GGCGGGGGGCGCGCGGGCGGCGG + Intergenic
1132555449 16:570063-570085 GGGGCCGCGCGCTCGGGCGGCGG - Exonic
1132560218 16:590114-590136 GCTGAGGTGCGCCCGGGCGCGGG + Intronic
1132586004 16:705970-705992 AGCGCGCCGCGCGCGGGGGCCGG - Intronic
1132639285 16:970462-970484 GGCGGGGCCGGCCCGGGCCCTGG - Intronic
1132663781 16:1072749-1072771 GGCTCCGGGCTCCCGGGCGCCGG - Intergenic
1132719649 16:1309482-1309504 GCCGCCGCGCGCCCGCGCCCCGG - Intronic
1132719654 16:1309492-1309514 GGCGCGCGGCGGCGGGGCGCGGG + Intronic
1132719765 16:1309861-1309883 GGCTCGGCGGGGCGGGGCGCGGG - Intronic
1132789693 16:1678599-1678621 GGGGAGGGGCGCCCGGGCTCTGG + Intronic
1132942165 16:2513782-2513804 GGCAGGGCGGGGCCGGGCGCCGG + Intronic
1133029712 16:3004589-3004611 CGGGCGGAGCGCGCGGGCGCGGG - Intergenic
1133040673 16:3058576-3058598 GCGGCGGCGCGCCCGGACCCCGG + Exonic
1133220086 16:4316091-4316113 GTGGCGGAGCGGCCGGGCGCCGG + Intronic
1133292782 16:4734076-4734098 AGCGCGGGACGCCCGAGCGCCGG + Exonic
1133311293 16:4848082-4848104 GGCGCGGGCCGCCCGCCCGCTGG + Intronic
1134163851 16:11915209-11915231 GGCGCCCCGAGCCCGGGAGCCGG - Intronic
1134849726 16:17470433-17470455 GGCACTGCCCGCCCGGGCTCTGG - Exonic
1134849831 16:17470766-17470788 GGCGCCGTGCGCCCGGAGGCTGG - Exonic
1136453910 16:30369991-30370013 GGCGCGGCCCGCCTGGGTCCCGG - Exonic
1136536387 16:30902308-30902330 GGCGCGCCAGGCCCGGGCCCTGG + Exonic
1136570655 16:31094618-31094640 GGCGGCGCGCGCCCGGGACCGGG - Exonic
1136778997 16:32885599-32885621 GGCGCGGGCCGGCCGGGGGCCGG + Intergenic
1136891621 16:33975919-33975941 GGCGCGGGCCGGCCGGGGGCCGG - Intergenic
1137787753 16:51151886-51151908 GGCGAGGCGCGCCGGCCCGCGGG + Intergenic
1138179161 16:54930734-54930756 GGCGAGGCGCGCCTGGCGGCCGG + Intergenic
1139403023 16:66696888-66696910 GGCGGGGCGAGGCGGGGCGCCGG + Intergenic
1139466058 16:67154840-67154862 GGCGCTGCGGGACCCGGCGCTGG - Exonic
1139557058 16:67719101-67719123 GGCATGGCGCGGCCGGGAGCGGG - Intronic
1140223157 16:73058347-73058369 GGCGCGGGGAGCGCGGGCGGCGG + Intronic
1140458131 16:75116282-75116304 GGCGGGGCGCGGCGGGGCGGGGG + Intronic
1140475674 16:75238280-75238302 GGCGCAGTGTGCCCGGGGGCTGG - Intronic
1140723100 16:77788650-77788672 GGCGCGGGGCGCACGGGCTGCGG - Exonic
1141608672 16:85169511-85169533 GGCGCGGCGCGGCCATGAGCGGG + Intergenic
1141720037 16:85750970-85750992 CGCGAGGCCCGCCCGGGCGCTGG + Exonic
1142130874 16:88430945-88430967 GGCGGGTCTCGCCCGGGCCCCGG + Exonic
1142240007 16:88940772-88940794 GGAACGACGCGCCCGGGCGCTGG - Intronic
1142378961 16:89721241-89721263 GGCGCGGGGCGGGCAGGCGCCGG - Intronic
1142379133 16:89721778-89721800 GGCGCGGCGCGCCTGGGGCCCGG + Exonic
1203081408 16_KI270728v1_random:1147688-1147710 GGCGCGGGCCGGCCGGGGGCCGG + Intergenic
1142631462 17:1229055-1229077 GGGGCTGCGCGCCCGCTCGCGGG + Intergenic
1142670668 17:1486075-1486097 TCCGCGGCGGGCCTGGGCGCTGG + Intronic
1142810619 17:2393966-2393988 GGCGGGGCGCGGCCGGGGGAGGG + Intronic
1142836861 17:2593863-2593885 GGCGCGCTGGGCCCGGGCCCGGG - Exonic
1143150776 17:4806893-4806915 GGCGCGGGACGCCCCGACGCCGG + Intergenic
1143155392 17:4833338-4833360 GGCGCGGAGCGACCGCGCACTGG - Intergenic
1143181632 17:4987429-4987451 TGAGCGGCGCCCCCTGGCGCGGG + Intronic
1143521549 17:7446988-7447010 GGCGGGGGGCCTCCGGGCGCGGG + Intronic
1143554374 17:7651488-7651510 CGCGGGGCGAGTCCGGGCGCGGG - Exonic
1144565179 17:16353598-16353620 GACCCGGCCCGCCCGGCCGCTGG + Intronic
1144847050 17:18225563-18225585 GGCCCCGCGCGCCCGCGCCCGGG + Intergenic
1145110243 17:20156001-20156023 GGGGCGGGGCCCACGGGCGCGGG + Intronic
1145190756 17:20841227-20841249 GGCGCACCGCACCCGGGCGCAGG + Intronic
1145243591 17:21253281-21253303 GGCGCGGCGCCGGCGGGGGCCGG + Exonic
1145265110 17:21376305-21376327 TGCGCGGCGCGGCGCGGCGCGGG + Exonic
1145265113 17:21376310-21376332 GGCGCGGCGCGGCGCGGGGCGGG + Exonic
1145265172 17:21376545-21376567 GGTGCGGGGCGCCGGGGCGTAGG + Exonic
1145815707 17:27793657-27793679 GGCGCGGCGTGCGAGGCCGCCGG - Intronic
1146057649 17:29589301-29589323 AGCGCGGCGGGGCCGGGGGCGGG - Intronic
1146057695 17:29589426-29589448 CGGGCGGCGGGCCCGGGCGGCGG + Exonic
1146197341 17:30824712-30824734 GGCCCGGCGCGGCCTCGCGCAGG + Exonic
1146281744 17:31549562-31549584 AGGGCGGCGCGGCCGGGGGCGGG - Intergenic
1146398686 17:32487381-32487403 GGCGGGGTGCGCCGAGGCGCGGG + Intronic
1146398693 17:32487396-32487418 GGCGCGGGGCGGAGGGGCGCAGG + Intronic
1146703251 17:34980647-34980669 GGCGCGGCGGGGCCCGGCGTGGG + Intronic
1147015702 17:37489935-37489957 GGCGCGGCGCGGCGCGGAGCGGG - Exonic
1147150312 17:38510367-38510389 GGCGCGGCGGGCGCGGGGCCTGG + Exonic
1147315480 17:39618158-39618180 GGCGGGGCGGGGCCGCGCGCCGG + Intergenic
1147740849 17:42670220-42670242 CGCGCGGCGGGGCCGGGGGCGGG + Exonic
1148079440 17:44959791-44959813 GGGGTGGCGCGCCCGGGGGAGGG - Exonic
1148090264 17:45019101-45019123 GGCGCGGGCGGCCCGGGCGGGGG + Intergenic
1148323726 17:46771760-46771782 GGCGCGGCGCGGCGCGGCGCGGG - Intronic
1148493405 17:48037630-48037652 GGCGCGGGGATCCCGGGCGGCGG - Intronic
1148852350 17:50561258-50561280 CCCGCGGGGCGCCGGGGCGCAGG - Intronic
1148930156 17:51120953-51120975 GGCCAGGCGCGGCCGGGGGCGGG + Intergenic
1149313947 17:55421743-55421765 AGGGCCGCGCGCCCGGCCGCCGG - Exonic
1149491010 17:57085308-57085330 GGCGCTGCGGGCCGGGCCGCGGG + Intronic
1150643554 17:66964865-66964887 GGCGCGGCGGGCCGGGCCGGCGG + Intergenic
1150830376 17:68512856-68512878 GCCGCGGCGCGCGGGGGCGAAGG - Intronic
1151453541 17:74213471-74213493 GGCGGGGCGGGCGCGGGCCCAGG + Intergenic
1151559163 17:74861546-74861568 GCCCCGCCGCGCCCGGGCTCCGG - Intergenic
1151660749 17:75516742-75516764 GGCGAAGAGCTCCCGGGCGCTGG - Exonic
1151705568 17:75765242-75765264 GGGGCGGGGCGTCCGGGCGCGGG - Exonic
1151987794 17:77555367-77555389 GGAGCTGGGCGCCCGGGAGCTGG + Intergenic
1152245602 17:79183207-79183229 AGCGCGGGGCGCACGTGCGCCGG + Intronic
1152349762 17:79778075-79778097 CGGGCGGCGGGCCGGGGCGCGGG + Intergenic
1152362518 17:79839258-79839280 GCCGGAGCGCGCCGGGGCGCTGG + Exonic
1152625853 17:81387606-81387628 CCCGCGGCGGGGCCGGGCGCGGG - Intergenic
1152703872 17:81833114-81833136 GGCCGGGCGGGGCCGGGCGCGGG - Intronic
1152721894 17:81927493-81927515 GCGGCGGCGGGCCCGGGCGGTGG - Intronic
1152834386 17:82519901-82519923 GCGGCGGCGCTCTCGGGCGCGGG + Exonic
1153051811 18:907711-907733 GGCTCGGAGCCGCCGGGCGCAGG + Exonic
1153219173 18:2847211-2847233 GGCCCCGCGTGCCCTGGCGCTGG + Exonic
1153219377 18:2847955-2847977 GGCGGGGCGCGCCCGGGCCGGGG + Intronic
1153457522 18:5296252-5296274 GGCGCGCGGAGCCCGCGCGCGGG + Intronic
1154241597 18:12658106-12658128 GGCGGGGCGGGGCGGGGCGCCGG - Exonic
1155096462 18:22560235-22560257 GGCGCTCCGCTCCGGGGCGCGGG + Intergenic
1155152845 18:23136036-23136058 GGCGCGGCCAAGCCGGGCGCCGG + Exonic
1157529449 18:48409192-48409214 CGCGCGCCGGGCTCGGGCGCCGG - Intronic
1157867156 18:51197105-51197127 GGCCCGAAGCGCCGGGGCGCCGG + Exonic
1159045713 18:63367136-63367158 GGCCCGGAGCGGCCGGGCGGGGG + Exonic
1160229041 18:77032547-77032569 GGCGAGGCGCGGCCATGCGCTGG + Intronic
1160567830 18:79798143-79798165 TGCGCGGTGCGCGCGGGCGCGGG + Intergenic
1160630901 18:80246437-80246459 GGCACGCTCCGCCCGGGCGCAGG + Intronic
1160631204 18:80247412-80247434 GGGGCGGCGCCCCCAGGCCCCGG + Exonic
1160668432 19:344504-344526 GGCGCGGGGCGGGCGGGGGCCGG - Intronic
1160671672 19:367785-367807 GGAGCCGGGCGCCCGGCCGCTGG + Intronic
1160766825 19:812549-812571 AGCGCGGCGGGGCCGGGGGCGGG - Exonic
1160807871 19:1000583-1000605 GGCGGCGCGGGCGCGGGCGCGGG - Exonic
1160913101 19:1483816-1483838 GGTGCGGCGGGGCCGGGCGGGGG - Exonic
1160937812 19:1605474-1605496 GCCGCGGCGCGCACGCGCGCGGG + Exonic
1160983834 19:1828396-1828418 GCCGCGGGGCGCCAGGGCGGGGG + Exonic
1161264869 19:3359537-3359559 GGCGCGGCGCGCCCCCTCCCTGG + Intergenic
1161309406 19:3585689-3585711 GACGAGGCGCGGGCGGGCGCGGG - Exonic
1161560371 19:4969468-4969490 GGCGGGGCGCGCCCAGGGGCGGG + Intronic
1161721449 19:5904809-5904831 GGCGGGGCCCTCCCGGGGGCGGG + Intergenic
1161955046 19:7489039-7489061 GGCGCGCCGCGCCAGGGGGCGGG + Intronic
1162019703 19:7862908-7862930 GGCGCGGCGCATCAGGGGGCGGG - Intronic
1162374432 19:10296377-10296399 GGCGCGGCGCTGCTGGCCGCGGG + Exonic
1162398403 19:10430943-10430965 GGCGGGGCGCGCGCGGGGCCAGG - Intronic
1162760418 19:12885535-12885557 GACGTGGCGGGACCGGGCGCGGG + Exonic
1162975786 19:14206506-14206528 GGAGCGGCGCCGCCGGGCGGCGG - Intergenic
1163020890 19:14480252-14480274 GGCGCTGCTCGCATGGGCGCAGG - Intronic
1163282154 19:16324772-16324794 GGCGCGGCGCGCGCGGGGGCCGG - Intergenic
1163304788 19:16471502-16471524 GACCCTGCCCGCCCGGGCGCCGG + Intronic
1163729531 19:18941150-18941172 GGCGCGGAGGGCGCGGGCCCGGG - Intronic
1163804132 19:19385941-19385963 CGCGGGGCGCGCTCGGGCGGCGG - Exonic
1163826868 19:19528909-19528931 GCCGAGGTGAGCCCGGGCGCCGG - Exonic
1164693127 19:30225723-30225745 GGCGCGGCGCGGGGGGGCGGCGG + Intergenic
1164693886 19:30229040-30229062 GGCGCGGCGCGACCAGCAGCCGG - Intronic
1164834751 19:31349883-31349905 GGCGCGGCGCCCCCGCGGGCGGG - Intergenic
1164835145 19:31350971-31350993 CAGCCGGCGCGCCCGGGCGCAGG - Intergenic
1165154382 19:33778269-33778291 GACGCGGGGCGCCCGGGAGCTGG - Intergenic
1165213698 19:34254625-34254647 GGCGCGGCGGGCGCAGGCGGGGG + Intronic
1165329069 19:35131447-35131469 GGCGGGGCCCGCACAGGCGCCGG + Exonic
1165924858 19:39320746-39320768 GGAGCGGCGGGCGGGGGCGCGGG - Intergenic
1166294690 19:41883225-41883247 GGCTCGGCGATCCCGGGCCCTGG - Intronic
1166317980 19:41999200-41999222 GGCTCGGGCCGCCCGGGCGTCGG + Exonic
1166373113 19:42313385-42313407 GGCGCAGCGCGGGCGCGCGCAGG - Exonic
1166375691 19:42325742-42325764 GGCGGGGCGCGAGCGGGTGCCGG - Intronic
1166567567 19:43774498-43774520 GGCGGGCCCCGCACGGGCGCCGG + Exonic
1166759550 19:45216037-45216059 GGCACGGCGAGCCCTGGCCCAGG + Intronic
1166853557 19:45771450-45771472 GGCGCGGCGTGCCCCAGCGTGGG + Intronic
1166888254 19:45973947-45973969 GGGGCGGCGGGCGCGGGCGGCGG + Intergenic
1167433567 19:49466241-49466263 GGCGTGGGGGGCCCGGGTGCAGG + Exonic
1167466139 19:49651890-49651912 GCCGGGGCGGGCGCGGGCGCCGG - Exonic
1167628191 19:50606194-50606216 CGCGCGGCGGGCCCGCGGGCTGG + Intergenic
1168076389 19:53982742-53982764 GGCGCGGGTGGCGCGGGCGCGGG - Exonic
1168459083 19:56538853-56538875 GGCGGGGCGCGGCCGGGGGCGGG + Intergenic
1168536105 19:57172086-57172108 GGCGGGGCGCGCGAGGGGGCGGG + Intergenic
1168536112 19:57172103-57172125 GGCGGGGCGCGCGAGGGGGCGGG + Intergenic
1168536119 19:57172120-57172142 GGCGGGGCGCGCGAGGGGGCGGG + Intergenic
1168536126 19:57172137-57172159 GGCGGGGCGCGCGAGGGGGCGGG + Intergenic
1168536133 19:57172154-57172176 GGCGGGGCGCGCGAGGGGGCGGG + Intergenic
1168536140 19:57172171-57172193 GGCGGGGCGCGCGAGGGGGCGGG + Intergenic
1168536147 19:57172188-57172210 GGCGGGGCGCGCGAGGGGGCGGG + Intergenic
1168536154 19:57172205-57172227 GGCGGGGCGCGCGAGGGGGCGGG + Intergenic
1168641462 19:58034288-58034310 GGGGAGGCGGGCCCGGGCCCGGG + Intronic
1168718924 19:58544372-58544394 GGCGCCTCACGCCCGGGGGCGGG - Intronic
926035179 2:9630717-9630739 GGCGCGGAGGCCCCGCGCGCAGG + Intronic
926130828 2:10302523-10302545 GGGGCGGGGGGCGCGGGCGCAGG + Intergenic
926250974 2:11155341-11155363 GGCGGGGCGGGCCCGGGGGCGGG + Intronic
926718607 2:15942668-15942690 GGGGCTGCGGGCACGGGCGCTGG - Exonic
926914344 2:17878511-17878533 GGCCCGGGGCGCCCGGCTGCGGG + Intronic
927965087 2:27263195-27263217 GGCGGGGCGCTCCCGGGCTCTGG - Exonic
927980309 2:27370712-27370734 GGCACGGCACGGCCGGGCTCCGG - Exonic
928420887 2:31137498-31137520 CGCGCGGCGCACCCGGCCTCCGG + Intronic
929647030 2:43637692-43637714 GGCGCGGCGCGAGCGGTCCCGGG + Intronic
929692653 2:44087321-44087343 GGCGCGGCGGCTCCGGGCCCAGG - Intergenic
930011399 2:46940979-46941001 AGCGAGGCGCCCCCGGGCGCCGG + Intronic
930124094 2:47783035-47783057 GTCGCCGCGCGCCCGGGGGCGGG + Intronic
930872823 2:56184923-56184945 GGCGCGGCGCGGCTGGGAGCGGG + Intronic
931321386 2:61177395-61177417 GGCGGGGCGGGGCCGGGGGCGGG + Intergenic
931763651 2:65436386-65436408 GGCGCGGCCCGGCCGCGCGCAGG - Intergenic
934717027 2:96550290-96550312 GGCGGGGCGGGCCCGGGTGCTGG + Intronic
935112424 2:100105153-100105175 GGCCGGGCGGGGCCGGGCGCGGG - Intronic
936396955 2:112138535-112138557 GGCGCCGCGCGGCCGGGGGGCGG - Exonic
937203779 2:120223192-120223214 GGTGTGGCGCGCGCGGGCACGGG + Exonic
937208619 2:120252986-120253008 GGCGCGGCGCCCGCGGGCCCCGG + Intronic
937221502 2:120345302-120345324 TGCGCGGCCCGGCCGGGCGCGGG - Intergenic
937221755 2:120346097-120346119 GGGGCGGCGCGCCCGGAGCCCGG + Intergenic
938073079 2:128318576-128318598 CGCGCCCCGCGCCCGGGCCCCGG - Exonic
938320002 2:130356222-130356244 CGAGCGGCGCGCCCCGGCCCTGG + Intronic
938381030 2:130836825-130836847 GGGGCGGAGCGTCCGGGCGAGGG + Intergenic
938397757 2:130963615-130963637 GCGGCGGCGGGCGCGGGCGCGGG - Intronic
938875939 2:135531581-135531603 AGCGCGGCGCGGCGGGGCGACGG - Intronic
939375455 2:141359755-141359777 GGCGGGGCGGGGCGGGGCGCGGG - Intronic
940037981 2:149330297-149330319 GGCGCCGCGCTCCCGCCCGCAGG - Intronic
940211658 2:151261620-151261642 GGCGCGACGGGCCAGGGTGCAGG - Intronic
940293392 2:152098870-152098892 GGCGGGGCGCGCTAGGGCGGCGG + Intronic
940774936 2:157875866-157875888 GGCGCGGCGCGGGGCGGCGCGGG + Intergenic
942116840 2:172736129-172736151 GGCGCAGCGCGGCCGGGCTGCGG + Intronic
942748717 2:179264612-179264634 GGCGGAGCGGGCCCGGGCGGCGG + Exonic
942799615 2:179860991-179861013 CGGGCGGCGCGCCCAGGTGCAGG + Intronic
943645994 2:190408412-190408434 GGCTCGGGGCGCCGGGGCGGCGG - Exonic
944221657 2:197310209-197310231 GGCGCCGCCGGCCCGGGCCCCGG - Intronic
944457560 2:199911315-199911337 GCCGCGGCCCGGCCGGGAGCCGG - Exonic
944766707 2:202871688-202871710 GGCGCGGGGCTCGCGGGCGGTGG - Intronic
946404422 2:219484795-219484817 GGCGCGGGGCTCCCCGGTGCTGG + Exonic
946431177 2:219628011-219628033 GGGGAGGCGCCCCCGGGCGGCGG - Exonic
947651072 2:231786626-231786648 GGCGGGGCGGGCACGGCCGCGGG - Intronic
947723243 2:232381671-232381693 GGCGGGGGGCGCCAGGTCGCAGG - Exonic
947724087 2:232386827-232386849 TGCGCGGCGCGGCGGAGCGCCGG - Intergenic
947727589 2:232409748-232409770 GGCGCGGGGCGCCAGGTCGCAGG - Exonic
948116115 2:235495018-235495040 CTCGCGGCGCGGCGGGGCGCAGG - Intronic
948207989 2:236173026-236173048 CGCGCGGTGAGCGCGGGCGCTGG - Intergenic
948459089 2:238120570-238120592 GGCAGGGGGCGCCCAGGCGCGGG - Intronic
948479101 2:238239455-238239477 GGCGGGGCGGGCGGGGGCGCCGG - Intronic
948874468 2:240819584-240819606 CGCGCAGGGCGGCCGGGCGCGGG - Intronic
949017582 2:241722100-241722122 TGCGTGGAGGGCCCGGGCGCAGG + Intronic
1168757119 20:325578-325600 GGAGCGGCGCGCGCGGGCCGCGG + Exonic
1168804423 20:664150-664172 CGCGGGGCGCGCGGGGGCGCAGG - Exonic
1168878130 20:1185174-1185196 GGCGAAGGGCGCCCGGCCGCCGG + Intronic
1169065508 20:2692683-2692705 GGGGCGGCGCGGCCGGCCGAGGG - Intergenic
1170026138 20:11891198-11891220 GGCGCGTCGGGCCCGCGCGGAGG + Intronic
1171175653 20:23049513-23049535 GGCGCGCCGCGTGCAGGCGCCGG + Exonic
1171430729 20:25081897-25081919 GTCGCGCCGTGCCCGGGCCCGGG - Exonic
1172118069 20:32583555-32583577 GGCGCGGCCCGACCGGGCCGGGG + Intronic
1172245599 20:33443403-33443425 GGCGCCGCGGAGCCGGGCGCCGG - Exonic
1172347642 20:34216303-34216325 GGTGCCGCGCGGGCGGGCGCTGG + Intronic
1172474568 20:35226993-35227015 GGCGCGCGGGGCCGGGGCGCGGG + Intronic
1172944102 20:38674569-38674591 GGCGGGGCGCCCCGGGGCTCTGG - Intergenic
1173279977 20:41618785-41618807 GACCTGGCGCGCTCGGGCGCCGG + Intergenic
1173322353 20:41999273-41999295 GGCGGGACGCGCTCGGCCGCTGG - Intergenic
1173454054 20:43189650-43189672 GGCGCTCTGAGCCCGGGCGCCGG + Exonic
1173488448 20:43458516-43458538 GGCGCGGAGCGCGCGGGGGTGGG - Intronic
1173827593 20:46057622-46057644 GGCCGGGCGCGCTCGGGCCCGGG - Exonic
1174343830 20:49915282-49915304 GGCTCGGCTGGCCCGGGAGCGGG - Intronic
1174607027 20:51768443-51768465 GGCGCGGCGCCGGCGGGCGGCGG - Exonic
1174804691 20:53594516-53594538 GGCACGGCGCGCGCGTGCGCGGG - Intronic
1175367735 20:58467300-58467322 GCTGCGGAGCGCCCGGGCTCAGG - Exonic
1175424710 20:58855974-58855996 GCCGCAGAGCGCCCGGGCGCAGG - Intronic
1175429530 20:58891689-58891711 GGCGGGGCGCGGCCGGGCTGCGG - Intronic
1175715421 20:61252128-61252150 GGCGCGGGGGGCGCGGGCGCGGG + Intergenic
1175715660 20:61252934-61252956 GGCGCGCGGCTCCCGGGCGATGG - Intronic
1175911474 20:62407221-62407243 GGCCCGGCGGGGCCGGGGGCCGG + Exonic
1176005717 20:62861402-62861424 GCGGCGGCGGGCCCGGGCGCAGG - Exonic
1176015544 20:62929353-62929375 GGCGGGGCGCGCCTGGGCCTCGG + Intronic
1176131729 20:63499197-63499219 GGCGGGGCGCGGACGCGCGCGGG + Exonic
1176131790 20:63499375-63499397 AGCGCGGCGGGCCCGGGAGACGG + Intergenic
1176178639 20:63739787-63739809 GGCGCGGCGCGGGCGGCGGCCGG + Intronic
1176221076 20:63969664-63969686 GGCGCGGGGCGCGGGGGCTCGGG + Intronic
1176283390 20:64328015-64328037 GGCGGGGAGCGCGAGGGCGCGGG + Intergenic
1176510611 21:7745154-7745176 GACCCGGCGCGACCGGGAGCCGG - Intronic
1176548462 21:8211877-8211899 GGCGCGGCGGGGCCGGACGACGG - Intergenic
1176556356 21:8256085-8256107 GGCGCGGCGGGGCCGGACGACGG - Intergenic
1176556902 21:8257774-8257796 GGCGCGGCGCGGCCGCGAGCCGG - Intergenic
1176567393 21:8394912-8394934 GGCGCGGCGGGGCCGGACGACGG - Intergenic
1176567940 21:8396592-8396614 GGCGCGGCGCGGCCGCGAGCCGG - Intergenic
1176575295 21:8439127-8439149 GGCGCGGCGGGGCCGGACGACGG - Intergenic
1176575844 21:8440811-8440833 GGCGCGGCGCGGCCGCGAGCCGG - Intergenic
1176733347 21:10521377-10521399 GGCACGGCGCGCGCGTGCGCGGG + Intergenic
1178644724 21:34375683-34375705 GACCCGGCGCGACCGGGAGCCGG - Exonic
1179375482 21:40846815-40846837 CACGCGGCGCGGCCGGGCTCCGG + Exonic
1179375491 21:40846877-40846899 GGGGCGCGGCGCCCGGGAGCAGG - Exonic
1179511926 21:41879132-41879154 GGCGCGCGGCTGCCGGGCGCGGG + Exonic
1179675002 21:42975028-42975050 TGCGGCGCGCGCCCCGGCGCGGG + Intronic
1179971380 21:44838083-44838105 GGCGGGGCGTACCCGGGCGCTGG - Intergenic
1180018217 21:45101280-45101302 GACACGGCCCGCCCGCGCGCAGG - Intronic
1180211538 21:46297840-46297862 TGCGCGGTGCTCCCGGGCGGGGG - Intergenic
1180699685 22:17774501-17774523 GCCGGGGCGGGCCCGGGCGTGGG - Intronic
1180852765 22:19029753-19029775 GGGCCGGGGCGGCCGGGCGCGGG + Intergenic
1180962045 22:19766533-19766555 TGCCCGGCGCGCCCGGAGGCCGG + Exonic
1181006640 22:20016686-20016708 GGCGCGGTGCGGCGCGGCGCGGG + Exonic
1181082927 22:20426064-20426086 GGCCCGGCCGGCCCGGGCCCGGG - Exonic
1181085523 22:20437770-20437792 CGCGGGGCGGGCACGGGCGCGGG + Exonic
1181167104 22:20989689-20989711 GGCGTGGGGAGCCAGGGCGCAGG + Intronic
1181167116 22:20989726-20989748 GGCACGGGGAGCCAGGGCGCAGG + Intronic
1181283518 22:21736125-21736147 GGAGCGCCGCGCTCGGACGCAGG + Intergenic
1181478064 22:23180751-23180773 GGCGGGGCGCGCCGGGGGGAAGG - Exonic
1181631884 22:24155948-24155970 GGCGCGGCCGGACGGGGCGCCGG - Intronic
1181745470 22:24952743-24952765 GGCGCGGCGCGGGCTGGCGGTGG + Intronic
1182226204 22:28800565-28800587 GGCGCGGCGAGGCTGGGCGCTGG - Exonic
1182296842 22:29315126-29315148 GGCGCGGCCCGTCCGTGGGCCGG + Exonic
1182355341 22:29720242-29720264 GGCCCGGCGGCCCGGGGCGCGGG + Exonic
1183535660 22:38399061-38399083 GGCACGGCGCGTGCGTGCGCGGG - Intergenic
1183692739 22:39400012-39400034 TGCGCGGCGGGCCCGGCCCCCGG + Intronic
1184046761 22:41976880-41976902 GGCGCGGCGGCGCGGGGCGCAGG + Exonic
1184046771 22:41976906-41976928 GGCGCGGCGGGGCCGCGGGCCGG + Exonic
1184153053 22:42649432-42649454 GGCGGGGCGGGCGCGGGGGCGGG + Intronic
1184184823 22:42857410-42857432 GGCGCTGCACGCGCGTGCGCAGG + Intronic
1184342112 22:43891769-43891791 GGCGCGGGGCTCGCTGGCGCAGG + Exonic
1184412265 22:44332008-44332030 AGCTCGGCGAGCCCGGGCGAGGG - Intergenic
1184523138 22:45007535-45007557 GGCGCGGCGCGGGCGGGGGCGGG + Intronic
1184720305 22:46308769-46308791 GGCCCGCCTCACCCGGGCGCCGG + Exonic
1185037927 22:48489446-48489468 GGCGCGGTGGGCCGGGGCCCGGG + Exonic
1185259596 22:49854051-49854073 GGCGCGGCCCGGCCCGGCCCCGG - Intronic
1185296720 22:50058322-50058344 GGCGGGGGGCGCGGGGGCGCGGG + Intergenic
1185398544 22:50604551-50604573 GGCGCGGCGGGCGCGGGCGGCGG - Exonic
1185415273 22:50706004-50706026 GGCGCGGCGTGGCCAGGTGCAGG - Intergenic
1203253346 22_KI270733v1_random:128182-128204 GGCGCGGCGGGGCCGGACGACGG - Intergenic
1203253895 22_KI270733v1_random:129869-129891 GGCGCGGCGCGGCCGCGAGCCGG - Intergenic
1203261400 22_KI270733v1_random:173260-173282 GGCGCGGCGGGGCCGGACGACGG - Intergenic
1203261951 22_KI270733v1_random:174948-174970 GGCGCGGCGCGGCCGCGAGCCGG - Intergenic
949414215 3:3799239-3799261 GGCGCAGCGCGGCGGGGCTCGGG - Intronic
950518067 3:13480282-13480304 GGCGGGGCGGGGCGGGGCGCGGG - Exonic
950583547 3:13878374-13878396 TGCGCGGGGCGGCGGGGCGCGGG + Intronic
951544486 3:23810811-23810833 GGGGCGGCGTGGCCGGGCGGTGG + Intronic
953391505 3:42536366-42536388 GGCGCGGCCAGCCCCGGCCCTGG + Exonic
954110395 3:48429923-48429945 CGCGGGGCGAGGCCGGGCGCTGG - Intronic
955911567 3:63863933-63863955 GGCGCGGCGCGGCGCGGCTCAGG - Intergenic
956080147 3:65549090-65549112 GGCCCTGCGCTCCGGGGCGCGGG + Intronic
956604991 3:71065025-71065047 GGCGCGGCGCGGCGCGGCGCGGG - Intronic
956605008 3:71065080-71065102 GGGCCGGGGCGCGCGGGCGCGGG - Intronic
959530713 3:107431470-107431492 GGCGCGGTGCACAAGGGCGCGGG + Intergenic
960223772 3:115146996-115147018 GGCGGGGCGGGGCGGGGCGCGGG + Intronic
961202581 3:125056165-125056187 CGCGCGGCGGGCCCGGAGGCGGG + Intergenic
961446425 3:126983617-126983639 GGCTCGGCGGGCCCGGCCGGGGG - Intergenic
961540870 3:127598484-127598506 GGCGCGTGGCGGGCGGGCGCCGG + Intronic
961599885 3:128052393-128052415 GGCGCGGCGCGGCGCGGGGCGGG - Exonic
961735905 3:129002021-129002043 GGCGCTGCGCGCCGAGCCGCCGG + Exonic
961827501 3:129606679-129606701 GGCGAGGCGCGGCCGGGAGCCGG + Exonic
963605596 3:147409922-147409944 GGCGCGGCGCGCCCGGGCGCTGG - Exonic
964509764 3:157437814-157437836 GGCGGGGCGCGCCCTGGCCGCGG + Exonic
967867786 3:194204308-194204330 GGCGCGGAGCCCCCTGGCCCGGG + Intergenic
968051709 3:195658695-195658717 AGCGCGGCGCGCCCGAGCTTGGG + Intergenic
968104106 3:195989638-195989660 AGCGCGGCGCGCCCGAGCTTGGG - Intergenic
968178190 3:196569042-196569064 GGCGGCGCGGGCGCGGGCGCGGG + Exonic
968302408 3:197627228-197627250 AGCGCGGCGCGCCCGAGCTTGGG - Intergenic
968434176 4:576373-576395 GGCGAGGCGCGCGGGGCCGCGGG - Intergenic
968636660 4:1684420-1684442 GGCGCGGCGCGGCTGAGGGCCGG - Intergenic
968674624 4:1871058-1871080 AGCGCGGCGCCCGCGGGCGCCGG + Intergenic
968850277 4:3073981-3074003 GGGGCGCCGAGCGCGGGCGCAGG - Intergenic
968916959 4:3500756-3500778 GGTGCGGCACGCACGGGCCCGGG + Intronic
968965204 4:3766120-3766142 GGCTCGGCGCGCCGGGGCGCCGG - Intergenic
969113350 4:4857047-4857069 GGGGCGGGGGGCCCGGGGGCGGG - Intergenic
969240374 4:5893109-5893131 GGCGTGGCGCGCGCCGGGGCGGG + Intergenic
969330319 4:6470931-6470953 GGCTCGGGGCGCCCTGGCCCGGG - Intronic
969619066 4:8269882-8269904 GCCGCTGCGGGGCCGGGCGCCGG - Exonic
970195043 4:13544293-13544315 GCCGCTGTGCCCCCGGGCGCCGG + Exonic
970319705 4:14863050-14863072 GGGGCGGCGCGTGCGGGGGCGGG - Intergenic
973110312 4:46390086-46390108 GGCGCGGTGCGCGCCGGCGGTGG + Intronic
973774795 4:54233169-54233191 AGCGCGGCGCGCAGGGGCGCAGG + Intronic
976704598 4:88007696-88007718 GGCGCCGCGCACCCGCGCGCCGG + Exonic
978503676 4:109434192-109434214 GGCGCGGGGCGCGCGGGGGTGGG + Intronic
979455656 4:120922922-120922944 CGGGCTTCGCGCCCGGGCGCGGG - Intergenic
981550536 4:145937550-145937572 GGCGCGGGGCGGCCGGGCGGGGG - Intronic
981550545 4:145937565-145937587 GAGGGGGCGCGCCGGGGCGCGGG - Intronic
982573198 4:157076112-157076134 ACCGCGGCGCGCCACGGCGCAGG + Exonic
983940097 4:173529001-173529023 GGCGCGGCCCCCCCAGGCCCGGG + Exonic
984973582 4:185210419-185210441 AGCCCGCCGCGCGCGGGCGCCGG - Intronic
985068423 4:186144919-186144941 CGCGCGGCGGGCGCGGGCGCGGG + Exonic
985537509 5:473406-473428 GGCGCGCGGAGCCCGGGCGCTGG + Intronic
986330700 5:6714203-6714225 GGCGCGGTGGGGCCGGGCGGCGG - Intergenic
986721550 5:10564222-10564244 GGCGGGGCGGGGCGGGGCGCGGG - Intergenic
987193176 5:15500160-15500182 GGCGCAGCTCGCCCGCGGGCCGG - Intergenic
987340448 5:16935475-16935497 GGCGGCGCGCGCCGGGGCGCGGG - Intronic
990381856 5:55227103-55227125 GGGGCGGCGCGGCCGGCCGTCGG - Exonic
990954648 5:61330943-61330965 GGCGCCGCGCACCCGGGTGCCGG + Intergenic
991245717 5:64506573-64506595 GGTGCAGTGCGCCCCGGCGCGGG - Exonic
991489205 5:67166383-67166405 GGCGCGGAGCGGCCAGCCGCGGG + Exonic
993727358 5:91383424-91383446 AGCGCGGCGCGGCGCGGCGCGGG - Intergenic
994171301 5:96662302-96662324 GGAGCGGAGGGCCCGGGAGCGGG - Exonic
997870200 5:137499349-137499371 GGCGCGGCGTCCGCGGGCGGAGG + Intronic
997984512 5:138492105-138492127 GGCGCGGGGCGGACGGGGGCGGG - Intergenic
999188434 5:149730151-149730173 CGCGCGGCGCCCGCGGGAGCCGG - Intergenic
1000071403 5:157743953-157743975 GGGGCGGCGGGCGCGGGCGCGGG + Exonic
1002093496 5:176817855-176817877 GCCGCGGGGCAGCCGGGCGCGGG + Intronic
1002190212 5:177473801-177473823 GGAGCGGCGCGCAGGGGCGGTGG - Intronic
1002305726 5:178281523-178281545 GGCACGGCGCTCCGGGGCCCAGG + Intronic
1002712742 5:181204923-181204945 TGCTGGGAGCGCCCGGGCGCGGG - Exonic
1002888074 6:1312984-1313006 GGGGCGGCGGGGCCAGGCGCGGG + Exonic
1002888171 6:1313419-1313441 GGGGCGGCGGGCGCGGGCGGCGG - Exonic
1003076770 6:2989186-2989208 GGCGTGGCGAGCCGGGTCGCGGG - Intronic
1003868679 6:10384860-10384882 CGCGCGCCGGGCCGGGGCGCGGG + Intergenic
1004044460 6:12011807-12011829 GGCGCGGGACGCCCAGGCGCCGG - Intronic
1004044618 6:12012229-12012251 AGCGCGGGGCGCGCGGGCGGGGG - Intronic
1004140573 6:13013864-13013886 GGCCCCGGGCGCCCGGGGGCCGG + Intronic
1004193987 6:13487737-13487759 TGCGCGCTGCGCCCGGGCCCCGG + Intergenic
1004272941 6:14211331-14211353 GGCGCGGCTCGCGCGGACCCGGG - Intergenic
1007558010 6:42782792-42782814 GGCGCGGCGGGGCCGCGAGCAGG + Intronic
1012450535 6:99349429-99349451 GGGCCGGCGCGGCCCGGCGCGGG + Exonic
1012475628 6:99613218-99613240 GGCGCGGCGAAATCGGGCGCCGG - Exonic
1013372701 6:109483616-109483638 GGCGGGGCGCGGCCAGGGGCGGG + Intergenic
1015149241 6:130019916-130019938 GGCGCGGCGCGGCACGGCGCGGG - Intronic
1015503143 6:133953486-133953508 GGTGCGGGGCGTCTGGGCGCGGG + Intronic
1016340933 6:143060851-143060873 GGCGCCGGGCGCGCGGGGGCGGG - Intronic
1017103135 6:150865870-150865892 GGCGCGGAGGGCCCGGGGGCTGG - Exonic
1017662388 6:156687320-156687342 GGCGCGGGGCGCGCGGGGTCCGG + Intergenic
1017671947 6:156777649-156777671 GGCGTGGCGAGGCCGGGCGGGGG - Intergenic
1017671973 6:156777716-156777738 GGCGGCGCGGGCGCGGGCGCGGG + Intergenic
1017877611 6:158537096-158537118 AGCCCGGCGCCCCCGGGCGAAGG + Intronic
1018017776 6:159727472-159727494 GGCGGGGCGGGGCCGGGCGGCGG + Intronic
1018612950 6:165661818-165661840 GGCGCTCCACGCCCGGGCACGGG + Intronic
1018669483 6:166167351-166167373 AGCGCGGCGCGCGCGGGCTCCGG + Intronic
1018734805 6:166679760-166679782 GGAGCGGCGCGGGCGGGAGCTGG + Intronic
1018876526 6:167826866-167826888 GGCGGGGCGCGGGCGGGTGCGGG + Intergenic
1018942605 6:168319461-168319483 GGCGCGGCGGGCGCGGGCGGGGG + Exonic
1019279484 7:192807-192829 GGCGCGACGGGCCTGGGCGGTGG - Intergenic
1019360341 7:601605-601627 GGCCGGGCGGGGCCGGGCGCAGG - Intronic
1019457472 7:1138051-1138073 GGCGCGGCGCGACCGGGCGGCGG - Exonic
1019487914 7:1297739-1297761 GGCTCTGGGCGCCCGGGAGCGGG - Intergenic
1019662574 7:2232843-2232865 GGCCCGGCTCGCGCGGGCGGCGG - Intronic
1020080257 7:5282887-5282909 GGAGGGGCGGGGCCGGGCGCGGG + Intronic
1020089793 7:5332713-5332735 GGCGCGGTGCTGACGGGCGCAGG + Exonic
1020260178 7:6526589-6526611 GGGGCGGCGCGGCGGGGCGCTGG + Exonic
1020727299 7:11831908-11831930 GGCGCTGGGCGTCCGGGAGCCGG - Exonic
1021450339 7:20778274-20778296 GGAGCGGCGGGCCCGGGCCGGGG + Intergenic
1022396220 7:29989802-29989824 GGGGCGGCGGGCCCCAGCGCCGG - Intronic
1022814949 7:33905033-33905055 CGCTGGGGGCGCCCGGGCGCAGG - Exonic
1023638590 7:42237120-42237142 GGTGCGGCGCGGGCGGCCGCGGG + Intronic
1024043829 7:45574477-45574499 GGCCCGGGGCGCCGGGGCGCGGG - Intronic
1025198665 7:56949310-56949332 GGCGGGGCGGGGCCGAGCGCGGG - Intergenic
1025673287 7:63627626-63627648 GGCGGGGCGGGGCCGAGCGCGGG + Intergenic
1026017484 7:66682500-66682522 GTCGGGGCACGGCCGGGCGCTGG - Intronic
1026522963 7:71132338-71132360 GGCGCGGCGCGCTCCGCCGTGGG + Exonic
1026837370 7:73647800-73647822 GGCGCGGCGCGGCCAGGGGCGGG + Intergenic
1026840415 7:73667722-73667744 GGCGCGGCGCGGCCGGGGCGGGG + Intergenic
1027232662 7:76281736-76281758 GCCGCGGCGCCCCCGGCCCCGGG + Exonic
1029207630 7:98878842-98878864 GGCGCAGCGCTCGCGGGCGCGGG + Intronic
1029537022 7:101163076-101163098 GGCGCGGCGCGCGCAGGAGGAGG - Exonic
1029896504 7:103989742-103989764 GGGGCGGCGCGCGGGGGCGGGGG - Intergenic
1030216004 7:107044617-107044639 GGGGCGGGGCGCCCGGGCGGGGG + Intergenic
1032119324 7:129144983-129145005 GGCGCGGAGACCCCGGGCGCCGG + Exonic
1032279949 7:130492181-130492203 GGCGCGGCGCCGCCCTGCGCGGG + Exonic
1032298794 7:130668388-130668410 AACGGGGCGCGCGCGGGCGCCGG + Intronic
1032525659 7:132576987-132577009 GCCGCGGCGCGGCCGGCCGCGGG - Exonic
1033220506 7:139523988-139524010 GGGGCGGCGGGGGCGGGCGCGGG - Exonic
1034147045 7:148883535-148883557 GGGTCGGCGCGCCCGGGACCGGG + Intronic
1034223051 7:149460323-149460345 CGCGCGGGGCGAGCGGGCGCGGG + Intronic
1034649217 7:152676174-152676196 GGCGCAGTGCGCACGCGCGCGGG - Intergenic
1034911563 7:155002659-155002681 GGCGCGGGAGGCCCGGGCCCGGG - Intronic
1034982999 7:155490351-155490373 GGCGGGGCGAGGCCGGGAGCTGG - Intronic
1035244584 7:157554013-157554035 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244602 7:157554068-157554090 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244620 7:157554123-157554145 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244638 7:157554178-157554200 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244656 7:157554233-157554255 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244674 7:157554288-157554310 GGTGCGGCCAGGCCGGGCGCCGG + Intronic
1035244692 7:157554343-157554365 GGTGCGGCCAGGCCGGGCGCTGG + Intronic
1035266069 7:157690895-157690917 GGCGCGGCGCGGGCGGGCTCAGG + Intronic
1035289559 7:157829076-157829098 CGCGGGGCGCAGCCGGGCGCGGG + Intronic
1035573309 8:688165-688187 GCCGTGGCGAGCCGGGGCGCAGG + Intronic
1035717071 8:1763401-1763423 GGCGGGGCGCGGCGGGGGGCGGG - Intronic
1035717080 8:1763418-1763440 GGCGGGGCGCGGCGGGGGGCGGG - Intronic
1035717089 8:1763435-1763457 GGCGGGGCGCGGCGGGGGGCGGG - Intronic
1035717098 8:1763452-1763474 GGCGGGGCGCGGCGGGGGGCGGG - Intronic
1035717107 8:1763469-1763491 GGCGGGGCGCGGCGGGGGGCGGG - Intronic
1035717116 8:1763486-1763508 GGCGGGGCGCGGCGGGGGGCGGG - Intronic
1035717125 8:1763503-1763525 GGCGGGGCGCGGCGGGGGGCGGG - Intronic
1035717134 8:1763520-1763542 GGCGGGGCGCGGCGGGGGGCGGG - Intronic
1035717143 8:1763537-1763559 GGCGGGGCGCGGCGGGGGGCGGG - Intronic
1035717152 8:1763554-1763576 GGCGGGGCGCGGCGGGGGGCGGG - Intronic
1035717161 8:1763571-1763593 GGCGGGGCGCGGCGGGGGGCGGG - Intronic
1035717170 8:1763588-1763610 GGCGGGGCGCGGCGGGGGGCGGG - Intronic
1036797930 8:11769579-11769601 GGCGGGGTGCGCGCAGGCGCAGG - Intergenic
1037116852 8:15237435-15237457 GGGGACGCGCACCCGGGCGCAGG - Intronic
1037947743 8:22999762-22999784 CGGGCGGCGCGCAGGGGCGCCGG - Intronic
1037977665 8:23224843-23224865 GGCGCGCCCTGCCCGGGCCCGGG + Exonic
1038205051 8:25458158-25458180 GGCGCGGCGGGCCGGGGGTCGGG - Intronic
1038540266 8:28385633-28385655 GGCGCGGGAGGGCCGGGCGCGGG + Intronic
1038727696 8:30095693-30095715 GGCGCGGCGCCCTCGGGCAACGG + Intronic
1039936586 8:42051615-42051637 GGCGCGGGGCCCGCGAGCGCGGG + Intronic
1041028605 8:53712520-53712542 CGAGCGGGGCGCCCGGGCGCGGG + Intergenic
1041108956 8:54467492-54467514 AGCGCGGGGAACCCGGGCGCCGG + Intergenic
1041690138 8:60679589-60679611 GGCGATGGGCGCGCGGGCGCGGG + Intronic
1042155421 8:65840920-65840942 GCCGCGGGGCGCGCGGGAGCTGG + Intronic
1042271818 8:66962616-66962638 GGCGGGGCGGGCTCGGGGGCGGG + Intergenic
1042858901 8:73294490-73294512 GGCGGGGTGCGCCCGGGGGCGGG + Intronic
1043502948 8:80874269-80874291 GGCGCGGCGGCCGCGGGCGGGGG + Intronic
1044692631 8:94895311-94895333 GGCGCGGCGCGCGGGCACGCGGG - Intronic
1044819280 8:96145008-96145030 GAGGCTGCGGGCCCGGGCGCGGG - Exonic
1045098848 8:98825725-98825747 GGGGCGGGGCGGCCGGGGGCGGG - Intronic
1045098860 8:98825745-98825767 GGGGCGGGGCGGCCGGGGGCGGG - Intronic
1045098872 8:98825765-98825787 GGGGCGGGGCGGCCGGGGGCGGG - Intronic
1045098884 8:98825785-98825807 GGGGCGGGGCGGCCGGGGGCGGG - Intronic
1045098896 8:98825805-98825827 GGGGCGGGGCGGCCGGGGGCGGG - Intronic
1045098908 8:98825825-98825847 GGGGCGGGGCGGCCGGGGGCGGG - Intronic
1045098920 8:98825845-98825867 GGGGCGGGGCGGCCGGGGGCGGG - Intronic
1045231400 8:100310154-100310176 GGGGCGGGGCGGCCGGGGGCGGG - Intronic
1045320927 8:101080807-101080829 TGGGCGGCGCGGCAGGGCGCCGG + Intergenic
1045327295 8:101126680-101126702 GCGGCGGCGCGGCCGGGAGCGGG - Intergenic
1047024508 8:120811605-120811627 GGGGCTGGGCACCCGGGCGCGGG - Exonic
1047499353 8:125430064-125430086 GGCAGCGCGCGCTCGGGCGCAGG - Intergenic
1047951507 8:129939495-129939517 GGCGGGGCCCGCGCTGGCGCGGG - Intronic
1047961842 8:130016704-130016726 GGCGCGGCGCGCGCTGACGCCGG - Intronic
1048308095 8:133297375-133297397 AGCCCGGCGCGCCCGGGAGGAGG - Exonic
1049585359 8:143430416-143430438 GTCGGGGCGCGGCCGGGCGCGGG - Intergenic
1049620911 8:143597955-143597977 GGCGCGGGGGGCCCGGGCAGGGG - Exonic
1049664205 8:143835786-143835808 GGTGCGGCGCGGCCTGGCGGAGG - Intronic
1049762223 8:144336751-144336773 GGTTGAGCGCGCCCGGGCGCTGG - Intergenic
1049844197 8:144792209-144792231 GGCGCGGCGGCCTCGGGGGCGGG - Intronic
1049850476 8:144827617-144827639 GGCGCGGCGGGCGCGGACTCGGG + Intronic
1050305315 9:4299945-4299967 AGCGCGGCGCGCACGGGCACCGG - Intronic
1051170262 9:14314150-14314172 GGCGGGGCGCGCGCGGGAGAGGG + Intronic
1052048549 9:23821756-23821778 GGCGCGGCGCGGCGCGGCGCGGG - Intronic
1052192847 9:25678352-25678374 GGGGCCGCGCGGCCAGGCGCGGG + Exonic
1052362232 9:27573498-27573520 GTCGGGGCGGGCCCGGGGGCGGG - Intronic
1053066314 9:35071984-35072006 GGCGCGGCGCCCCGGGGCTTTGG - Intronic
1053129166 9:35605555-35605577 AGCGCGGCCTGCCCGGGCCCTGG + Exonic
1056350296 9:85742169-85742191 GGCGGAGCGCGCACGGGAGCGGG + Intergenic
1056475174 9:86946298-86946320 GGCGCGGGCGGCCCCGGCGCGGG - Exonic
1056560635 9:87726402-87726424 GGCGCGGCGCGGCCTGGCTGCGG - Intronic
1056643381 9:88388914-88388936 GGCGCTGCGCAGTCGGGCGCGGG + Intronic
1057313384 9:93955010-93955032 GGCGCGGCGCCCTTGGGCCCGGG + Exonic
1057489564 9:95510863-95510885 GGCGCGGGGAGTCCGGGAGCCGG - Intronic
1057600049 9:96450129-96450151 GGCGCCGCGGGGGCGGGCGCCGG + Intergenic
1057739259 9:97697436-97697458 GGGGTGGCCTGCCCGGGCGCTGG + Intergenic
1057758085 9:97853117-97853139 GGGGAGGTGCGCCCGGGCCCCGG + Intergenic
1058885743 9:109320372-109320394 CGCGGGGCGCGGCGGGGCGCGGG - Exonic
1058908251 9:109498354-109498376 GCCGCGACGGGCCCGCGCGCCGG + Intergenic
1059375200 9:113876089-113876111 GGCGAGGCCGGCCCGGGGGCGGG + Intergenic
1059406052 9:114098753-114098775 GGCGCGGCGCACCCTGGCGGAGG + Intronic
1059414758 9:114155865-114155887 GGCGCGGCGGGGCGGGGGGCTGG + Exonic
1060544758 9:124453381-124453403 GAGGCGGCGCGCTGGGGCGCGGG + Exonic
1060700918 9:125747955-125747977 GGCGCGGCCCGCACGGGGTCGGG - Intronic
1060713027 9:125889745-125889767 GGCGCGCCGCGGCGGGGAGCGGG + Intronic
1060770168 9:126326795-126326817 GGCGGGGCGCGGCCTGGCGGCGG - Intergenic
1060945869 9:127569095-127569117 GGAGCGGGGCGCCGGGGTGCAGG - Intronic
1060979782 9:127785601-127785623 GGCCCGGGGCGGCCGGGCGAGGG - Intergenic
1060979862 9:127785831-127785853 GGCGCGGGGAGCCGGGGCGCCGG - Intronic
1060996645 9:127877812-127877834 GTCGCCGCGCACCCGGGCTCGGG - Intergenic
1061128223 9:128689766-128689788 GGCGCGGCGCGGCCGGGCGGGGG + Intronic
1061450487 9:130664627-130664649 GGCCCGGAGCTCCCCGGCGCCGG - Exonic
1061559624 9:131394225-131394247 GGCGCGGCCGGGCCGGGCGATGG - Intronic
1062022611 9:134326546-134326568 GGCGCGGCCGGCCCGGGCCCGGG - Intronic
1062346680 9:136118361-136118383 GGCCCGGCGCGGCGCGGCGCAGG - Intronic
1062372132 9:136245454-136245476 GGTGAGGCGCGCCCCCGCGCGGG - Exonic
1062491889 9:136808665-136808687 GGCGCGGCGCCCCGGGCCGGCGG - Intronic
1062542040 9:137045832-137045854 GCCGCGGGGCGCCCCGGGGCCGG - Intronic
1203469746 Un_GL000220v1:111329-111351 GGCGCGGCGGGGCCGGACGACGG - Intergenic
1203470295 Un_GL000220v1:113013-113035 GGCGCGGCGCGGCCGCGAGCCGG - Intergenic
1203477567 Un_GL000220v1:155301-155323 GGCGCGGCGGGGCCGGACGACGG - Intergenic
1203478116 Un_GL000220v1:156985-157007 GGCGCGGCGCGGCCGCGAGCCGG - Intergenic
1185747607 X:2584615-2584637 GGCGGGGGGCGCGGGGGCGCGGG + Intergenic
1186496449 X:10015540-10015562 CGCGCGGGGCGGCCGGGCGGCGG + Exonic
1187698230 X:21941293-21941315 CGCGCGGCGAGCCCGGGCTGGGG + Intronic
1187888118 X:23907904-23907926 AGCGCGTCGCGCCCGGGCAGCGG + Exonic
1188248617 X:27863985-27864007 GGCGGCGCGCGCCCGGGACCGGG + Intergenic
1190008071 X:46758995-46759017 GACGCGGCGCGCCCTGGCTCGGG - Exonic
1190266888 X:48831968-48831990 GCCGCGGCGGGGACGGGCGCGGG + Exonic
1197807633 X:130412791-130412813 GGCCCGACGCTCCCGGGAGCGGG + Exonic
1198388033 X:136147378-136147400 GGCGGGGCGCGCGCGGGGCCGGG - Exonic
1198879202 X:141261151-141261173 GGCCCGGCGCTCCCGGGAGCGGG - Intergenic
1199612664 X:149631488-149631510 CGCGCTGCGGGCTCGGGCGCGGG - Intronic
1199760119 X:150898706-150898728 GCCGCGCCGCGCGCGCGCGCGGG - Exonic
1199772825 X:150984696-150984718 GGCGGGGCGGGACCGGGAGCGGG - Intronic
1199881130 X:151974821-151974843 GGGGAGGCTCGCGCGGGCGCGGG + Intergenic
1200100750 X:153688287-153688309 GGCGGGGCCCGGCCGGGCGGCGG - Exonic
1200100808 X:153688455-153688477 GGCGCGGGCCGGCCGGGGGCCGG - Exonic
1200129012 X:153830947-153830969 GGCACGGGGCGCACGCGCGCCGG + Intergenic
1200163321 X:154019976-154019998 TGCGCGCCGCGGCCGCGCGCTGG + Exonic
1200229402 X:154436773-154436795 AGCGGCGCGCGCCCGGCCGCGGG + Intergenic
1200277840 X:154751110-154751132 GGCGCTGGGCGGGCGGGCGCTGG - Intronic
1200402799 X:156029359-156029381 GGCGCGGCGCGCCTTTGCGACGG + Intergenic
1202197100 Y:22307495-22307517 GGCGCCGAGCTCCCGGGAGCGGG - Intergenic