ID: 963605597

View in Genome Browser
Species Human (GRCh38)
Location 3:147409928-147409950
Sequence GGCAATGGCGCGGCGCGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963605597_963605606 3 Left 963605597 3:147409928-147409950 CCCGGGCGCGCCGCGCCATTGCC 0: 1
1: 0
2: 2
3: 15
4: 79
Right 963605606 3:147409954-147409976 AGGCTAGGACTTCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 52
963605597_963605605 2 Left 963605597 3:147409928-147409950 CCCGGGCGCGCCGCGCCATTGCC 0: 1
1: 0
2: 2
3: 15
4: 79
Right 963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 64
963605597_963605604 -1 Left 963605597 3:147409928-147409950 CCCGGGCGCGCCGCGCCATTGCC 0: 1
1: 0
2: 2
3: 15
4: 79
Right 963605604 3:147409950-147409972 CTGCAGGCTAGGACTTCGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963605597 Original CRISPR GGCAATGGCGCGGCGCGCCC GGG (reversed) Exonic
900088735 1:910155-910177 GGGATTGGCTCGGCGCGCGCGGG + Intergenic
900135704 1:1116102-1116124 GGCGGTGGCGCCGCGCCCCCTGG + Intronic
900232854 1:1570521-1570543 GGCATTGGCGCTGAGTGCCCAGG - Intronic
900623123 1:3596473-3596495 GGGGATGGCGCGGGGTGCCCTGG - Intronic
900623142 1:3596517-3596539 GGGGATGGCGCGGGGTGCCCTGG - Intronic
900623161 1:3596561-3596583 GGGGATGGCGCGGGGTGCCCTGG - Intronic
900623214 1:3596693-3596715 GGGGATGGCGCGGGGTGCCCTGG - Intronic
902067487 1:13700279-13700301 GGCGCTGGCGCGGCGGGCGCGGG + Intronic
907909908 1:58816420-58816442 GGCAAAGGCGGGGCGCCGCCGGG + Intergenic
912955568 1:114152668-114152690 GGGAATGGCGTGTCGCGCCCTGG - Exonic
1064442954 10:15370559-15370581 CGCGATCGGGCGGCGCGCCCTGG + Intronic
1067025040 10:42837117-42837139 GGGACTGTCGCGCCGCGCCCGGG + Intergenic
1081733050 11:45384894-45384916 GGCAATGGAGGGGCTCCCCCAGG + Intergenic
1082802846 11:57427076-57427098 GGAAAGGGCGCGGAGAGCCCCGG - Exonic
1083893225 11:65607233-65607255 GCCAATGGCGGGGGACGCCCCGG + Intronic
1101482158 12:105108151-105108173 GGCTTGGGCGGGGCGCGCCCGGG + Intronic
1112112376 13:96316413-96316435 GGCAATGGAGCTGAGCACCCTGG - Intronic
1202922027 14_KI270723v1_random:35474-35496 GGCCATGGCGCTGCGTGTCCCGG - Intergenic
1202922901 14_KI270724v1_random:2139-2161 GGCCATGGCGCTGCGTGTCCCGG + Intergenic
1126837265 15:52679479-52679501 GGCAATGCCGCCGCTCGCCCCGG + Intronic
1127982658 15:64046159-64046181 GGCATTGGGGCGGCGGGCCCGGG + Intronic
1128812912 15:70585358-70585380 GGCAAAGGCGCGGCGCACCCGGG - Intergenic
1129983662 15:79897139-79897161 GGTAAGCGCGCGGCGCGCCGCGG - Intronic
1130411762 15:83653963-83653985 GGCAAGTGCACGGCGCGCCCAGG - Intergenic
1131510631 15:93047778-93047800 GGCAATGCCGCCGCGTGCCAAGG + Intronic
1132683723 16:1153779-1153801 GGCCAGGGGGCGGCGCGCCCAGG - Exonic
1137676679 16:50307069-50307091 GGCAAAGTCGTGGCGGGCCCGGG - Exonic
1137683248 16:50368893-50368915 GGCAGGGGGGCGGCGCGCGCCGG + Intronic
1142379131 16:89721772-89721794 GGCGACGGCGCGGCGCGCCTGGG + Exonic
1142671220 17:1488231-1488253 GGGAATGCGGCGGCGCGGCCCGG - Intronic
1143697201 17:8629962-8629984 GGCATTGGCTCTGCGCGGCCGGG - Intronic
1144952969 17:19004036-19004058 GGCCATGGCGCCGCCTGCCCGGG + Exonic
1147744495 17:42687010-42687032 GGGAATGGCGCCGCACGGCCAGG - Exonic
1151612038 17:75182661-75182683 GAAAATGGCGCGGAGCGCCCGGG + Intergenic
1155007254 18:21740710-21740732 GGCGATGGAGGGGCGGGCCCAGG - Intronic
1155928843 18:31685220-31685242 GGCATTACCGCCGCGCGCCCGGG + Intronic
1158478976 18:57803706-57803728 GGCGGGGCCGCGGCGCGCCCGGG + Intergenic
1161560367 19:4969462-4969484 GACAATGGCGGGGCGCGCCCAGG + Intronic
1161719263 19:5894219-5894241 GGCACTGGAGCGGAGAGCCCCGG - Intronic
1163320565 19:16572318-16572340 GGCCACGGCGCGGGGGGCCCGGG - Exonic
1163842255 19:19618598-19618620 GGCGATGGCGCGGGGCGCGGCGG + Exonic
1166797966 19:45439626-45439648 GGCAGGGGCGCCGCGCCCCCTGG - Intronic
1166832145 19:45645321-45645343 GGCGATGGCGGAGCGCGGCCCGG - Exonic
1167037813 19:47004327-47004349 GGCCAATGCGCGGCGCGCGCGGG + Exonic
1167915175 19:52734627-52734649 GGCTGCGGCGCGGCGCTCCCGGG + Intronic
1168307334 19:55442694-55442716 GGCGGGGGCGCGGCGAGCCCAGG - Exonic
926580827 2:14632265-14632287 GGCAATGTCGCTGCCTGCCCCGG + Intergenic
931321372 2:61177376-61177398 CGCCCTGCCGCGGCGCGCCCGGG - Intergenic
933658306 2:84906527-84906549 GGCATCGGCGCGGAGTGCCCAGG - Exonic
936518802 2:113199001-113199023 GCCAGGGGGGCGGCGCGCCCGGG + Intronic
937208618 2:120252980-120253002 GGTAAGGGCGCGGCGCCCGCGGG + Exonic
938305783 2:130253177-130253199 TGCAGTGGCGCAGAGCGCCCGGG - Intergenic
938448364 2:131394586-131394608 TGCAGTGGCGCAGAGCGCCCGGG + Intergenic
941111585 2:161423440-161423462 GGCCATGGCGTAGCGGGCCCCGG - Exonic
941905706 2:170715375-170715397 GGCAAGGGCGGGGAGGGCCCCGG + Exonic
946966465 2:225042385-225042407 GCCAATCGCGCCGCGGGCCCGGG + Exonic
948186815 2:236027624-236027646 GGCAATGGCGCTGCTGACCCTGG - Intronic
1173704204 20:45098173-45098195 CGCTATGGCGCGGCGCGCTGTGG - Exonic
1175258700 20:57662061-57662083 GACAATGGCGCGCTGAGCCCTGG - Intronic
1175847123 20:62065041-62065063 GGCGAGGGCGCGGCGGGCGCGGG + Exonic
1175847576 20:62066435-62066457 GGGACTGTCGCAGCGCGCCCTGG + Intergenic
1176015543 20:62929347-62929369 GGCGAGGGCGGGGCGCGCCTGGG + Intronic
1179902156 21:44399891-44399913 GGCAATAGCTCGGCGCTCCAAGG - Intronic
1179955389 21:44735410-44735432 GGCACTGGCGTGGAGCTCCCAGG + Intergenic
1180144992 21:45913875-45913897 GGCAATGGGGAGGCGTGCCCCGG - Intronic
1185259597 22:49854057-49854079 GACAATGGCGCGGCCCGGCCCGG - Intronic
963605597 3:147409928-147409950 GGCAATGGCGCGGCGCGCCCGGG - Exonic
968549751 4:1216170-1216192 GGCAGTGGCGCTGCGGGCCAAGG - Exonic
968907640 4:3462045-3462067 GGCAGTGGGGAGGGGCGCCCAGG + Intergenic
968965205 4:3766126-3766148 GGCTAGGGCTCGGCGCGCCGGGG - Intergenic
969362650 4:6674404-6674426 GGCAGAGGAGCGGGGCGCCCGGG + Intergenic
977908272 4:102501604-102501626 GGCCATGGCGCGGCGCTGACTGG + Exonic
978154522 4:105473952-105473974 GGCCATAGCACGGCGCGACCCGG + Exonic
985784621 5:1887295-1887317 GGCAAGAGCGCGGCGCCCGCGGG - Intergenic
990308650 5:54517949-54517971 GACCATGGCGCTGCGCGCCCGGG + Exonic
992910810 5:81394202-81394224 GGCACTGGCGCCGCCCGCCCGGG + Intergenic
1001159552 5:169301020-169301042 CGCAATGGGGCGTGGCGCCCGGG + Intronic
1012625748 6:101401978-101402000 GGCAACGGCGGAGCCCGCCCAGG + Intronic
1013619397 6:111873217-111873239 GGGAGAAGCGCGGCGCGCCCGGG + Exonic
1015626002 6:135181497-135181519 GGCCATGGCGCGGCGGGCGCGGG - Exonic
1015773536 6:136792261-136792283 GGCGAGGGCGCGGCGCGCGATGG - Exonic
1019395671 7:816582-816604 GCCAATCGCGGGCCGCGCCCCGG - Intergenic
1019676287 7:2314472-2314494 GGCGAGGGCGCGGCGCGGCAGGG - Intronic
1029537026 7:101163082-101163104 GGCCCAGGCGCGGCGCGCGCAGG - Exonic
1032119322 7:129144977-129144999 GGCCATGGCGCGGAGACCCCGGG + Exonic
1035609133 8:948661-948683 GGAAATGCCGCGGCGCTGCCCGG + Intergenic
1040471371 8:47738068-47738090 GGCCAGGGCGCGCCGCGCGCCGG + Exonic
1041673750 8:60517364-60517386 GGAAATGGAGCGGCGCGGCCAGG - Intronic
1041689886 8:60678655-60678677 GGCGCGGGCGCGGCGCGGCCCGG + Intergenic
1051170628 9:14315514-14315536 GGCGGGGCCGCGGCGCGCCCGGG + Intronic
1053290003 9:36873530-36873552 GGCAAAGGGGTGGCGTGCCCAGG + Intronic
1059406050 9:114098747-114098769 GGGGTTGGCGCGGCGCACCCTGG + Intronic
1060734166 9:126055712-126055734 GGCAATGGCACAGCGGGGCCTGG + Intergenic
1198184082 X:134237179-134237201 GGCAACCGCGCGGCCCGCGCTGG + Exonic
1200011866 X:153125951-153125973 GGCAATGGCCCTGCGCACCCGGG + Intergenic
1200027735 X:153273968-153273990 GGCAATGGCCCTGCGCACCCGGG - Intergenic
1200378201 X:155806599-155806621 GGCAATGGGGTGGCAAGCCCTGG - Intergenic