ID: 963605598

View in Genome Browser
Species Human (GRCh38)
Location 3:147409929-147409951
Sequence AGGCAATGGCGCGGCGCGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963605598_963605604 -2 Left 963605598 3:147409929-147409951 CCGGGCGCGCCGCGCCATTGCCT 0: 1
1: 0
2: 0
3: 6
4: 67
Right 963605604 3:147409950-147409972 CTGCAGGCTAGGACTTCGCGAGG 0: 1
1: 0
2: 0
3: 4
4: 44
963605598_963605606 2 Left 963605598 3:147409929-147409951 CCGGGCGCGCCGCGCCATTGCCT 0: 1
1: 0
2: 0
3: 6
4: 67
Right 963605606 3:147409954-147409976 AGGCTAGGACTTCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 52
963605598_963605605 1 Left 963605598 3:147409929-147409951 CCGGGCGCGCCGCGCCATTGCCT 0: 1
1: 0
2: 0
3: 6
4: 67
Right 963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963605598 Original CRISPR AGGCAATGGCGCGGCGCGCC CGG (reversed) Exonic
900012882 1:131722-131744 AGGCCCTGGCGGGGCGCACCAGG + Intergenic
900042947 1:487709-487731 AGGCCCTGGCGGGGCGCACCAGG + Intergenic
900064384 1:722706-722728 AGGCCCTGGCGGGGCGCACCAGG + Intergenic
900342380 1:2195049-2195071 AGGCAGTGCCGGGGCGGGCCGGG - Intronic
902067486 1:13700278-13700300 AGGCGCTGGCGCGGCGGGCGCGG + Intronic
902585832 1:17438298-17438320 GGGCAAGCGCGCGGCGCGGCCGG - Exonic
905414314 1:37794124-37794146 CGGCCATGGCGCGGCACGCTGGG + Exonic
1069709362 10:70478961-70478983 AGGCAGCGACGGGGCGCGCCCGG - Exonic
1076969219 11:123926-123948 AGGCCCTGGCGGGGCGCACCAGG + Intergenic
1077228660 11:1449147-1449169 AGGCCCTGGCCCGGCGTGCCCGG - Intronic
1084066136 11:66705368-66705390 TGGCAGCGGCGCGGCGGGCCCGG - Exonic
1084129106 11:67119565-67119587 CGGGAGCGGCGCGGCGCGCCGGG - Intronic
1094653400 12:32399286-32399308 AGGCAGTGGCGCGGCAGGGCGGG + Intergenic
1103830436 12:123774921-123774943 AGGCAATGGCCCTGCTCTCCAGG + Intronic
1122419176 14:101564488-101564510 AGGCATTGTCCTGGCGCGCCAGG - Intergenic
1125535980 15:40441383-40441405 GGGCGGTGGCGCGGCGCGCTCGG - Intronic
1127982657 15:64046158-64046180 AGGCATTGGGGCGGCGGGCCCGG + Intronic
1128812913 15:70585359-70585381 GGGCAAAGGCGCGGCGCACCCGG - Intergenic
1129016659 15:72474624-72474646 AGTCCATGGCGCGACGCGCGGGG - Exonic
1137676680 16:50307070-50307092 AGGCAAAGTCGTGGCGGGCCCGG - Exonic
1142379130 16:89721771-89721793 GGGCGACGGCGCGGCGCGCCTGG + Exonic
1142451454 16:90175196-90175218 AGGCCCTGGCGGGGCGCACCAGG - Intergenic
1144952968 17:19004035-19004057 AGGCCATGGCGCCGCCTGCCCGG + Exonic
1145888118 17:28396673-28396695 AGGCAATGCCCAGGCGGGCCTGG + Exonic
1147374498 17:40015815-40015837 GGGCGATGGCGCAGCGCTCCAGG + Exonic
1147745741 17:42693370-42693392 AGGCATTGGCACGGCCCTCCAGG - Exonic
1151612037 17:75182660-75182682 GGAAAATGGCGCGGAGCGCCCGG + Intergenic
1151780239 17:76240534-76240556 AGCCAATGGCGAGGCGGGGCGGG + Intergenic
1160646025 19:193852-193874 AGGCCCTGGCGGGGCGCACCAGG + Intergenic
1161795040 19:6381529-6381551 AGGCGATGGCTGGGCGGGCCGGG - Intronic
1162381298 19:10333417-10333439 CGGCGATGCCGCGGAGCGCCGGG - Exonic
1165781239 19:38435281-38435303 AGGCAATGGGGCTGGGCACCAGG - Intronic
925984684 2:9206555-9206577 GGGCATGGGCGCGGCGCGCGGGG + Intergenic
935163201 2:100547128-100547150 AGGCAATGATGCTGAGCGCCTGG - Intergenic
940650552 2:156436326-156436348 AGGCGGGGGCGCGGCCCGCCCGG + Intronic
1169345131 20:4823254-4823276 AGGCACTGGCGCGGGATGCCCGG - Intronic
1171501969 20:25600765-25600787 AGGCAATACCGCGGGGCTCCTGG - Intergenic
1176015542 20:62929346-62929368 GGGCGAGGGCGGGGCGCGCCTGG + Intronic
954238738 3:49277081-49277103 AGGCAGCGGCGGGGCGGGCCAGG - Exonic
960902220 3:122564411-122564433 AGGCCATGGCTCTGCGCGTCGGG - Exonic
963605598 3:147409929-147409951 AGGCAATGGCGCGGCGCGCCCGG - Exonic
965530297 3:169764650-169764672 AGGGAATCGCGCCGCGCGCGGGG + Intergenic
967171706 3:186827295-186827317 AGGCGAGGGCGCGGCGCCCGAGG + Intergenic
968371656 3:198225674-198225696 AGGCCCTGGCGGGGCGCACCAGG - Intergenic
968701309 4:2059425-2059447 GGGCAAGGGCGCGGCGCCCTCGG - Intergenic
968965206 4:3766127-3766149 CGGCTAGGGCTCGGCGCGCCGGG - Intergenic
969362649 4:6674403-6674425 AGGCAGAGGAGCGGGGCGCCCGG + Intergenic
985550049 5:528345-528367 GGGCAATGGCGCGGGGGACCTGG + Intergenic
988823845 5:34915287-34915309 AGGCGATGGCGGGGCGGGCCCGG + Intronic
990308649 5:54517948-54517970 GGACCATGGCGCTGCGCGCCCGG + Exonic
992910809 5:81394201-81394223 GGGCACTGGCGCCGCCCGCCCGG + Intergenic
1002730896 5:181331220-181331242 AGGCCCTGGCGGGGCGCACCAGG - Intergenic
1002753637 6:142884-142906 AGGCCCTGGCGGGGCGCACCAGG + Intergenic
1006334266 6:33412259-33412281 ATGCAATGGCGCAGCCCCCCCGG + Exonic
1006676958 6:35771436-35771458 AGGCAATGGGGCAGCACACCTGG + Intergenic
1015626003 6:135181498-135181520 GGGCCATGGCGCGGCGGGCGCGG - Exonic
1017812613 6:157994900-157994922 GGGCAATGGAGGGGCGCTCCTGG - Intronic
1019676288 7:2314473-2314495 GGGCGAGGGCGCGGCGCGGCAGG - Intronic
1021085895 7:16421032-16421054 AGGGAACCGCGGGGCGCGCCCGG + Intronic
1022629278 7:32070481-32070503 GGGCAAACGCGCGCCGCGCCTGG - Intronic
1032194209 7:129780274-129780296 AGCCAATGGCGCTGCGCGAGGGG - Intergenic
1034347691 7:150397304-150397326 ATGAACTGGCGCGGCTCGCCCGG - Exonic
1034347807 7:150397799-150397821 ATGAACTGGCGCGGCTCGCCAGG - Exonic
1049575626 8:143388521-143388543 AGGCATCGGCGCAGCGCCCCAGG - Intergenic
1056386156 9:86099158-86099180 GGGCAAGGGGGCCGCGCGCCCGG + Intronic
1059471181 9:114505583-114505605 AGGCAACGGCCAGGCGCACCGGG - Intergenic
1062499123 9:136844822-136844844 TGGCAAGGGCGCGGAGCGCCGGG - Exonic
1062653497 9:137590325-137590347 GGGCGAGGCCGCGGCGCGCCGGG + Exonic
1062755302 9:138283727-138283749 AGGCCCTGGCGGGGCGCACCAGG - Intergenic
1203579214 Un_KI270745v1:27899-27921 AGGCCCTGGCGGGGCGCACCAGG - Intergenic
1196793204 X:119482589-119482611 AGGAAATGGCCCGGCCCGCCAGG + Intergenic
1199924696 X:152450451-152450473 AGGCAATGGAGCTTCTCGCCGGG + Intronic
1200011865 X:153125950-153125972 GGGCAATGGCCCTGCGCACCCGG + Intergenic
1200027736 X:153273969-153273991 GGGCAATGGCCCTGCGCACCCGG - Intergenic