ID: 963605600

View in Genome Browser
Species Human (GRCh38)
Location 3:147409938-147409960
Sequence CTAGCCTGCAGGCAATGGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963605600_963605606 -7 Left 963605600 3:147409938-147409960 CCGCGCCATTGCCTGCAGGCTAG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 963605606 3:147409954-147409976 AGGCTAGGACTTCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 52
963605600_963605605 -8 Left 963605600 3:147409938-147409960 CCGCGCCATTGCCTGCAGGCTAG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963605600 Original CRISPR CTAGCCTGCAGGCAATGGCG CGG (reversed) Exonic
900608133 1:3532873-3532895 CTCCCCTGCAGGGAATGGTGAGG - Intronic
900636130 1:3666623-3666645 CTAGCCTGCAGCCAAGGCCAGGG - Intronic
903104549 1:21064195-21064217 GTGCCCTGCAGCCAATGGCGAGG + Intronic
903943761 1:26949254-26949276 CCAGCCTGCAGGCAGTGGACTGG + Intergenic
919065129 1:192684500-192684522 CTAGCTTGATGGCAATGGCATGG + Intergenic
920437727 1:205958831-205958853 CCAGCCTCCAGGCAGTGGCCTGG - Intergenic
922719608 1:227893557-227893579 CTAGCCTGTGGGCAATGGGACGG - Intergenic
924409049 1:243784303-243784325 CTAGACTGCAGGGAATGAGGGGG + Intronic
1081725430 11:45324171-45324193 CCAGCCTGCACCCAATAGCGTGG + Intergenic
1084858478 11:72003582-72003604 CTAGCCTGCACCCACTGGCTGGG + Intronic
1089281658 11:117379127-117379149 AGAGCCTGCAGACAATGGCAGGG - Intronic
1090864778 11:130690048-130690070 CTAGCCAGCAGGCATAGGTGTGG + Intronic
1093367603 12:18323136-18323158 CTAGGGGGCAGGCAATGGCAGGG - Intronic
1108529958 13:51319531-51319553 CTCGCCTGTAGGCAGTGGGGTGG - Intergenic
1109247902 13:59979542-59979564 CTAACCTGCAGCCGAAGGCGTGG + Intronic
1113007105 13:105718722-105718744 ATAGACTGCTGGCAATGGTGGGG + Intergenic
1121692213 14:95886048-95886070 CTAGCCAACAGGAAATGGAGCGG + Intergenic
1122114645 14:99521708-99521730 CTGGCCTGGAGGGAATGGGGTGG - Intronic
1123962307 15:25416877-25416899 CCAACCTGCAGTCAATGGAGGGG + Intronic
1125769130 15:42153499-42153521 CTGGCCTGGAGGCAATGGCCTGG - Intronic
1133455891 16:5942222-5942244 CTAGCCTGCAAACTATGGAGAGG - Intergenic
1137374603 16:47941868-47941890 CTAGCCAGCAGGCAACTGAGGGG + Intergenic
1139624686 16:68177085-68177107 CCAGGCTGCATGCAATGCCGTGG + Intronic
1139853266 16:69962958-69962980 CAAACCTGCAGGCCATGGTGTGG - Exonic
1139882237 16:70185867-70185889 CAAACCTGCAGGCCATGGTGTGG - Exonic
1142694947 17:1628467-1628489 CTAGACGGCGGCCAATGGCGCGG - Intronic
1147428781 17:40358698-40358720 CTAGGCTGGAGGCAACCGCGGGG + Intergenic
1147553045 17:41458446-41458468 CTATCCTGAAGGCAATGGGAGGG - Intergenic
1151716264 17:75832669-75832691 CTAGGCAGCAGGAAATGGGGAGG + Intronic
1156411143 18:36829077-36829099 CGAGCCTGCAGGCCGAGGCGTGG + Intronic
1156920536 18:42516982-42517004 TTATCCTGCAGGCAATGAAGGGG - Intergenic
1158616128 18:58988802-58988824 CTAGCCTGCTGACACTGGTGAGG - Intergenic
1158734648 18:60065854-60065876 GTAGCCTGCAGGCCATGGGTTGG + Intergenic
1160484450 18:79276272-79276294 CTTGCCTGGAGGCAGTGGAGTGG - Intronic
1160917758 19:1505809-1505831 CAAGCCGGCAGGCACTGGTGAGG - Exonic
1163670113 19:18622675-18622697 CCAGCCTACAGGCAATGGGGTGG + Intergenic
1164637159 19:29799996-29800018 CCAGCCTGCAGACCATGGCTTGG + Intergenic
1166552090 19:43672651-43672673 CCAGGCTGGATGCAATGGCGTGG + Intergenic
931997181 2:67850130-67850152 CCAGCCTACAGGCAAGGGTGGGG - Intergenic
934131646 2:88954546-88954568 CTAGCCTGCTGGGCATGGTGAGG - Intergenic
934135916 2:88996362-88996384 CTAGCCTGCTGGGCATGGTGAGG - Intergenic
934234402 2:90217411-90217433 CTAGCCTGCTGGGCATGGTGAGG + Intergenic
934931590 2:98430069-98430091 CGAGCCTGCAGCCATTGGGGTGG - Intergenic
935947703 2:108301226-108301248 CCAGGCTGCAGGCCATGGGGAGG + Intronic
936010753 2:108923859-108923881 CTAGGCTGCAGGCTCTGGGGAGG - Intronic
1173202554 20:40964906-40964928 CCAGCCTGAAGGCCATGGAGTGG - Intergenic
1174416774 20:50372767-50372789 CTAGCCTCCAGGCAGTGACCTGG + Intergenic
1174475462 20:50793084-50793106 CTAGCCAGCAGGCAAGGGCAAGG + Intergenic
1175189249 20:57199991-57200013 CTAGGCTGCAAGGAATGGAGAGG + Intronic
1175771618 20:61627907-61627929 CTGGCCTGCAGGGAAGGGAGGGG - Intronic
1175884291 20:62280133-62280155 CAAGACTGCAGGCAGTGGCTTGG - Intronic
1184190246 22:42889714-42889736 CGAGGCTGCAGGCAGGGGCGGGG + Intronic
1184451506 22:44585542-44585564 CTGCCCTGCAGGCCATGGAGGGG + Intergenic
1184717594 22:46290754-46290776 CAAGGCTGCTGGCAATGGTGAGG - Intronic
1184770102 22:46591975-46591997 CAAGCCTGCAGGCACAGGAGGGG - Intronic
951991408 3:28679495-28679517 CTTCCCTGCAGGAAATGGCTAGG + Intergenic
953778428 3:45843068-45843090 ATGGCCTGAAGGCAGTGGCGTGG + Intronic
954468995 3:50675386-50675408 GCAGCCTGCGGGCAGTGGCGGGG - Intronic
955241582 3:57182962-57182984 CAAGCCTGCAGGGACTTGCGGGG + Intergenic
963605600 3:147409938-147409960 CTAGCCTGCAGGCAATGGCGCGG - Exonic
968660627 4:1797375-1797397 CTAGCAGGCAGGCAGTGGGGGGG + Intronic
975156916 4:71082423-71082445 CTAGCAGGCAGGCAAGGGAGGGG - Intergenic
982799496 4:159686419-159686441 CTAGCATTAAGGCAATGGCAAGG - Intergenic
989982779 5:50663880-50663902 CTGGCCTGCAGCCATTGGCGGGG + Intergenic
997280632 5:132642038-132642060 CTACCCTGCAGGAAGTGGAGGGG - Intronic
999661725 5:153871384-153871406 CTAGCCTCAAAGCAATGGAGTGG + Intergenic
1001150552 5:169223886-169223908 GGAGGCTGCAGGCAATGGGGAGG + Intronic
1001851885 5:174974947-174974969 CTAGCCTTCATGGAATGGAGTGG - Intergenic
1001920697 5:175597078-175597100 CTGGCCTGCCGGCAGTGGAGGGG + Intergenic
1002304909 5:178277526-178277548 CTAGCCTGCTGCCCATGGCGAGG + Intronic
1006218903 6:32471086-32471108 CCAGGCTGGATGCAATGGCGTGG - Intergenic
1008916781 6:56796595-56796617 CTAGGATGCAGGCAATGGTTGGG + Intronic
1009931710 6:70183830-70183852 TTAGCCAGCAGGCAATTGCATGG - Intronic
1012770270 6:103424758-103424780 CTGGGATGCAGGGAATGGCGTGG - Intergenic
1018902185 6:168057201-168057223 CCAGCCTGCAGTCCAGGGCGCGG + Exonic
1019173742 6:170149297-170149319 CTACACTGCAGGCAGTGGAGGGG - Intergenic
1019173778 6:170149517-170149539 CTACACTGCAGGCAGTGGAGGGG - Intergenic
1019173789 6:170149579-170149601 CTACACTGCAGGCAGTGGAGGGG - Intergenic
1019173831 6:170149762-170149784 CTACACTGCAGGCAGTGGAGGGG - Intergenic
1019173870 6:170149982-170150004 CTACACTGCAGGCAGTGGAGGGG - Intergenic
1019173884 6:170150043-170150065 CTACACTGCAGGCAGTGGAGGGG - Intergenic
1024083150 7:45872719-45872741 CTCTCCTGCAGGCCATGTCGTGG + Intergenic
1028109371 7:86920751-86920773 CAAGCCTGCAGGTAATGGAGAGG - Intronic
1030984382 7:116223954-116223976 CTAGCCTGCATTCAATGGCAGGG - Intronic
1032236703 7:130130625-130130647 CTAGCCTGCTGGAACTGGCATGG + Exonic
1033814329 7:145054065-145054087 CTTGTCTGCACGCAATGGAGTGG + Intergenic
1036092295 8:5680285-5680307 TTAGGCTGTAGGCAATGGAGAGG + Intergenic
1038798190 8:30727691-30727713 CCTGCCTGCAGGCCATGGCACGG + Exonic
1048338457 8:133520598-133520620 CTAGACTGGAGGCTATGGTGGGG - Intronic
1050976088 9:11940379-11940401 GCAGCCTGCAGGCAATGGGTTGG + Intergenic
1053430344 9:38038163-38038185 CTGGCCTGCATGGAATGGCTGGG - Intronic
1190109589 X:47581529-47581551 CTAGCAAGCAGGGAATGGTGCGG - Intronic
1192200326 X:69062408-69062430 CTAGCCTGTAGGAGATGGCCAGG - Intergenic
1192496553 X:71620154-71620176 CTAGCCTGGAGGCTTTGGTGGGG - Intergenic
1192739141 X:73876293-73876315 CTTGCCTGAAGGCAATGGCTGGG - Intergenic
1200180469 X:154147342-154147364 CTGGCCTGCAGGCAAGTGCAAGG - Intronic
1200186297 X:154185737-154185759 CTGGCCTGCAGGCAAGTGCAAGG - Intergenic
1200191949 X:154222875-154222897 CTGGCCTGCAGGCAAGTGCAAGG - Intronic
1200197704 X:154260679-154260701 CTGGCCTGCAGGCAAGTGCAAGG - Intronic