ID: 963605605

View in Genome Browser
Species Human (GRCh38)
Location 3:147409953-147409975
Sequence CAGGCTAGGACTTCGCGAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963605598_963605605 1 Left 963605598 3:147409929-147409951 CCGGGCGCGCCGCGCCATTGCCT 0: 1
1: 0
2: 0
3: 6
4: 67
Right 963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 64
963605594_963605605 13 Left 963605594 3:147409917-147409939 CCCGGCCAGCGCCCGGGCGCGCC 0: 1
1: 0
2: 0
3: 32
4: 345
Right 963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 64
963605600_963605605 -8 Left 963605600 3:147409938-147409960 CCGCGCCATTGCCTGCAGGCTAG 0: 1
1: 0
2: 0
3: 8
4: 90
Right 963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 64
963605596_963605605 8 Left 963605596 3:147409922-147409944 CCAGCGCCCGGGCGCGCCGCGCC 0: 1
1: 0
2: 6
3: 108
4: 655
Right 963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 64
963605597_963605605 2 Left 963605597 3:147409928-147409950 CCCGGGCGCGCCGCGCCATTGCC 0: 1
1: 0
2: 2
3: 15
4: 79
Right 963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 64
963605595_963605605 12 Left 963605595 3:147409918-147409940 CCGGCCAGCGCCCGGGCGCGCCG 0: 1
1: 0
2: 2
3: 25
4: 258
Right 963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG 0: 1
1: 0
2: 0
3: 1
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963605605 Original CRISPR CAGGCTAGGACTTCGCGAGG TGG Exonic
903192518 1:21664621-21664643 CAGGCAAGGACTCCTCAAGGAGG + Intronic
920032849 1:203047992-203048014 AAGGCTAGGCCTGAGCGAGGAGG + Intronic
920215177 1:204357843-204357865 CAGGCTGGGTCTGGGCGAGGTGG + Intronic
920301093 1:204989537-204989559 CAGTCTGGGACCTCTCGAGGAGG + Intronic
921207029 1:212858121-212858143 CGGGCGAGAACTTCGGGAGGCGG - Intergenic
1065124329 10:22559720-22559742 CAGGCCAGGACTTCTCCAAGTGG + Intronic
1067578267 10:47421160-47421182 CAGGCTGGGACTGTGGGAGGAGG + Intergenic
1081598189 11:44473648-44473670 GAGGCTAGGCCCTCGGGAGGTGG + Intergenic
1089005537 11:115087728-115087750 CAGGCTGGGGCTTCTCGGGGAGG + Intergenic
1091207663 11:133832767-133832789 CAGGGCAGGACTTCGCGGGGCGG - Intergenic
1096499253 12:52055295-52055317 CAGGACAGGACTTAGCTAGGAGG - Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1122235142 14:100327145-100327167 CAGGCTAGGGCCCCGCCAGGAGG - Intronic
1123472494 15:20565498-20565520 CAGGCTAGCACTTCCCCAAGAGG - Intergenic
1123645510 15:22434855-22434877 CAGGCTAGCACTTCCCCAAGAGG + Intergenic
1123666762 15:22614422-22614444 CAGGCTAGCACTTCCCCAAGAGG + Intergenic
1123732799 15:23160489-23160511 CAGGCTAGCACTTCCCCAAGAGG - Intergenic
1123750933 15:23357869-23357891 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124283304 15:28381785-28381807 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124299395 15:28529828-28529850 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124320602 15:28708995-28709017 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124481891 15:30086354-30086376 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124488347 15:30138452-30138474 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124521701 15:30410847-30410869 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124536963 15:30555372-30555394 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124543437 15:30607426-30607448 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1124755180 15:32399868-32399890 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124761688 15:32452219-32452241 CAGGCTAGCACTTCCCCAAGAGG + Intronic
1124776940 15:32596849-32596871 CAGGCTAGCACTTCCCCAAGAGG - Intronic
1128700066 15:69797474-69797496 CAGTCTAGGGCTCCCCGAGGTGG + Intergenic
1136669147 16:31839949-31839971 GAGGCTAGGTCTTCGAGGGGTGG - Intergenic
1139492769 16:67295438-67295460 GAGGCTAGGTCTTTGCGAAGGGG + Intronic
1141181608 16:81756673-81756695 GAGGCGTGGACTTCGTGAGGCGG + Intronic
1142313635 16:89329173-89329195 CAGGCGGGGACTCCGTGAGGAGG + Intronic
1147949558 17:44099417-44099439 CAGGCTGGGACTTCCCATGGAGG - Intronic
1155919624 18:31590336-31590358 CAGGAGAGGACTCCGGGAGGTGG - Intergenic
1157209038 18:45725574-45725596 AGGGCTAGGACTTAGCGATGCGG - Intronic
1158624154 18:59057182-59057204 CTGGCCAGGACTTCCCGGGGAGG + Intergenic
931855965 2:66302021-66302043 CAGCCAAGGACATTGCGAGGTGG - Intergenic
932078984 2:68694278-68694300 CAGGCTACGACTTCACAAAGCGG - Intronic
932691949 2:73921004-73921026 AAGGCTGGGACTTTGCTAGGTGG - Intergenic
940453719 2:153871826-153871848 CAGGCTGGGGCTACGAGAGGAGG + Intergenic
944441639 2:199749233-199749255 CAGCCTAGGAGTTCCTGAGGGGG + Intergenic
946157763 2:217818204-217818226 CAGGCTGGGACTCCCCGGGGTGG + Exonic
948778919 2:240305051-240305073 CAGGCTGGGAGCTGGCGAGGAGG - Intergenic
1171210898 20:23316178-23316200 CAGACTAGGACATCCCTAGGTGG - Intergenic
1174320371 20:49737085-49737107 GAGGCTAGGAGTTCGAGACGAGG - Intergenic
1179433626 21:41344403-41344425 CAGGCGAAGACTTCGCGGAGCGG + Intronic
952506105 3:34008042-34008064 CAGGCTGGTGCTTCCCGAGGAGG - Intergenic
955988043 3:64595552-64595574 CAGGACAGAACTTTGCGAGGAGG + Intronic
959372882 3:105551087-105551109 CAGGCTAGGACTACACTAGCTGG + Intronic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
968160501 3:196423076-196423098 CAGGCGAGGACTTGGCGGGCTGG - Intronic
981148711 4:141356111-141356133 CTGGCTATGACGTCGCTAGGTGG + Intergenic
981212462 4:142124219-142124241 CAAGCTAGGACTTGGCAAAGGGG - Intronic
985472338 5:53809-53831 CAGTCCTGGACTCCGCGAGGGGG + Intergenic
1008827309 6:55712476-55712498 AAGGGTAGGACTTCTAGAGGTGG - Intergenic
1010978951 6:82348395-82348417 CAGACTGGGCCTTCGCTAGGTGG + Intergenic
1011945512 6:92896819-92896841 AAGGCTAGGGCATCGCTAGGTGG - Intergenic
1031752453 7:125593709-125593731 CTGCCTAGGACTTTGGGAGGTGG - Intergenic
1035903939 8:3488629-3488651 TATGCTAGGACTCAGCGAGGAGG - Intronic
1053425217 9:38005874-38005896 CAGGCCAGGACTTCTCATGGTGG + Intronic
1061349589 9:130053961-130053983 CAGCCTAGGACCGCGGGAGGCGG - Exonic
1062443378 9:136583443-136583465 CAGGCTAGGGTTTCTCGAGCTGG - Intergenic
1062525132 9:136975170-136975192 CCGGCTAGGACTGTGCAAGGTGG - Intergenic
1062664699 9:137663078-137663100 CAGGCCAGGACTGGGCGCGGTGG - Intronic