ID: 963609752

View in Genome Browser
Species Human (GRCh38)
Location 3:147452412-147452434
Sequence CTGGAGACACAGGTGGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 315}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
963609743_963609752 27 Left 963609743 3:147452362-147452384 CCGGGACATGGTGATTGAGTTGG 0: 1
1: 0
2: 2
3: 19
4: 113
Right 963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG 0: 1
1: 0
2: 0
3: 27
4: 315
963609742_963609752 30 Left 963609742 3:147452359-147452381 CCTCCGGGACATGGTGATTGAGT 0: 1
1: 0
2: 0
3: 8
4: 63
Right 963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG 0: 1
1: 0
2: 0
3: 27
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
963609752 Original CRISPR CTGGAGACACAGGTGGTTGA GGG Intronic
901157555 1:7150587-7150609 CTGGAGACACACTTGGTTGTCGG - Intronic
901748535 1:11390941-11390963 CAGGATACACAGATGTTTGATGG - Intergenic
902585456 1:17436567-17436589 CTGGAGACAGAGGTGGGCCAGGG + Intronic
903277856 1:22233108-22233130 CAGGAGCCAGAGGTGGGTGAAGG - Intergenic
903322995 1:22553706-22553728 CTGGAGACCCATGTGGTTCAGGG - Intergenic
903332256 1:22602187-22602209 CTGGAGGCACATGTGGGTGATGG + Exonic
903761160 1:25699761-25699783 CTGGAGACAGAGGTGCTTCATGG + Intronic
904307613 1:29600244-29600266 TTGGAGACATAGGTGCTAGAGGG + Intergenic
905551853 1:38847926-38847948 CTGGCTACACAGGAGGCTGAAGG + Intronic
906126924 1:43432531-43432553 CTGGGGACCCAGGTGCTTGGGGG - Exonic
906220285 1:44072899-44072921 CTAGAGAAATAGGTGTTTGAAGG + Intergenic
906312237 1:44762163-44762185 CTGGAGAGTCAGCTGGGTGAGGG + Intronic
906409601 1:45568064-45568086 CTGGAGGCACTGGTGGCTAAGGG + Exonic
907303498 1:53502060-53502082 GTGGAGACAGAGGAGGATGAAGG + Intergenic
908146290 1:61248157-61248179 CTGGAGGGACAGCTAGTTGAGGG - Intronic
909399817 1:75214398-75214420 CTAAAGACACAGGTGGGTAATGG + Intronic
909872202 1:80755732-80755754 TTGGAGACTCAGGAGGTTGGGGG - Intergenic
910071094 1:83214127-83214149 CTGGAGCCACAGGTGAGTGGAGG - Intergenic
910281125 1:85502821-85502843 CTGCAGACAGAGGTGGTAGGAGG - Intronic
911196694 1:95002076-95002098 CTGGAAACACTGGTTGTTGCAGG + Intronic
911297162 1:96132039-96132061 CTGGAGACAGTGGAGGTCGATGG - Intergenic
912155946 1:106920072-106920094 GTGGAAAAACAGGTGGTGGAAGG + Intergenic
915556430 1:156663423-156663445 CTGGAGACACAGCTGAGTCATGG + Intergenic
915606591 1:156955809-156955831 CAGGAGACACTGGTGTTTGCAGG + Intronic
915616451 1:157043283-157043305 CTGGATAGATGGGTGGTTGAAGG - Intronic
916406330 1:164501023-164501045 CTGGAGGAACAGGTGGCTGTGGG + Intergenic
917727127 1:177838803-177838825 CTGGAGAAAGATGAGGTTGAAGG + Intergenic
918080909 1:181207057-181207079 CTGGAGACACAGGAGACAGAAGG + Intergenic
918103979 1:181400683-181400705 CAGGAGACACAGGAGCTTTAGGG + Intergenic
918222967 1:182452786-182452808 CTGATGACACTGGTGGTTGTTGG - Intronic
918238244 1:182600284-182600306 GTGGAGACTCAGGTGTGTGAGGG + Exonic
919032368 1:192259443-192259465 TTGGAGACAGAGGGGATTGAAGG + Intergenic
920072362 1:203311620-203311642 TTGAAGACACACGTGGGTGAAGG - Intergenic
920130694 1:203729692-203729714 CTGGGGACACAGGTGCTTCCTGG + Intronic
920381851 1:205539340-205539362 GTGGAATCACAGGTGGCTGAAGG - Intergenic
920655030 1:207868614-207868636 ACGCAGAGACAGGTGGTTGAGGG - Intergenic
920841891 1:209562144-209562166 CTGGAAACACAGGGGGTGCAGGG + Intergenic
921535504 1:216344718-216344740 CTTAAGACAGAGGTGGTTAAAGG + Intronic
921951511 1:220934917-220934939 CTGGAGACTCAGCTCGTTTAAGG + Intergenic
922157946 1:223054499-223054521 CTGAACACAAAGGTGGGTGATGG - Intergenic
923036274 1:230287203-230287225 ATGGTGACACAGGTGGTGGGTGG - Intergenic
923744832 1:236690837-236690859 CTGGAGACACAGAGTGGTGATGG - Intronic
1064026904 10:11856266-11856288 CTGGAGACACAGGCCTTAGAGGG - Intronic
1064112152 10:12548827-12548849 CTGGAGATGCATGGGGTTGATGG - Intronic
1064430405 10:15265955-15265977 CAGGAGCCAGAGGTGGTAGAAGG + Intronic
1065747962 10:28859106-28859128 ATGGAGCCACAGGTGGATGAAGG - Intronic
1068566234 10:58578789-58578811 CTGCACACACAGGTGGGAGAGGG - Intronic
1068812786 10:61275408-61275430 CTGGAGACACAGGTAATCTAGGG + Intergenic
1068833615 10:61526666-61526688 CTGGAGACTCAGGAGGGTGCAGG + Intergenic
1072251743 10:93587176-93587198 CTGGAGCCACAGGTGACCGAGGG - Intronic
1072261855 10:93683958-93683980 ATGTAGACTTAGGTGGTTGATGG - Intronic
1072858256 10:98973499-98973521 TTGGAGACAAAGGTGTTTGCAGG - Intronic
1073439448 10:103544027-103544049 CGGGAGCCACAGGAGGTAGAGGG + Intronic
1074254718 10:111789751-111789773 CTGTAGACATAGGCAGTTGATGG - Intergenic
1075139175 10:119816157-119816179 TTGGAGAGCCAGGTGGTTTAGGG + Intronic
1076832985 10:133006258-133006280 CTGGAGACACAGGGTTTTGTGGG + Intergenic
1077452018 11:2654104-2654126 GTGGAGACACAGGTGGTGGCGGG + Intronic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1081559308 11:44198209-44198231 CTGTAGCCACAAGTGTTTGAGGG + Intronic
1081839589 11:46188154-46188176 CTGTATATACAGGAGGTTGATGG - Intergenic
1083031418 11:59596440-59596462 TTGGAGAAACTGGTTGTTGATGG - Intronic
1083473787 11:62902364-62902386 CTAGAGTTACAGGTGCTTGAAGG + Intergenic
1084006491 11:66326190-66326212 AGGGAGACACCGGTGGTGGAGGG - Intergenic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084128858 11:67118703-67118725 CTGGGGCCAAAGGCGGTTGAAGG + Intergenic
1084385964 11:68842785-68842807 CAGGGGACCCAGGGGGTTGAGGG + Intronic
1084711374 11:70845979-70846001 CTGGAGAAACAGGTGGCCAAGGG + Intronic
1084942808 11:72622687-72622709 CTGGAGACAGAGGAGGATGGGGG + Intronic
1085031514 11:73273758-73273780 ATGGAAAAACAGGTGGTGGATGG - Intronic
1085035320 11:73296558-73296580 CGGTAGACACAGGTGGTGGGTGG - Exonic
1085695824 11:78703651-78703673 CTAGAGACACAGGTGGCAAAGGG - Intronic
1085810345 11:79674968-79674990 CTGGAGACTCACGTGGTAGGAGG - Intergenic
1086011437 11:82108431-82108453 ATGAAGACTCAGGTGGTTGAGGG - Intergenic
1087174834 11:95087248-95087270 CTAGGGACAAAGGTGGTTGGTGG - Intergenic
1089980334 11:122766882-122766904 CTGGAGACATGGGTGGGTGGTGG - Intronic
1090653428 11:128825266-128825288 CTGGAGCCACTGGTGGATGGCGG + Intergenic
1091076999 11:132628659-132628681 CTGGGGACACAGGTGGTGTAAGG - Intronic
1091408577 12:224282-224304 TTGGGGACACAGGAGCTTGAGGG - Intronic
1092938511 12:13386161-13386183 CTGGAGACATGGCTGTTTGAGGG + Intronic
1094166887 12:27452350-27452372 ATGGAGACTCAGGAGGGTGAAGG - Intergenic
1096876988 12:54637091-54637113 TGGGAGACACAGGTGGGAGATGG + Intergenic
1097249217 12:57623196-57623218 GTGGAGAAACAGGTGGAAGATGG + Intronic
1100193031 12:92213135-92213157 ATGGAGAGACAGGTGATTGAGGG + Intergenic
1101623701 12:106417355-106417377 CTGGAGACCCAGGTGGAGGCTGG + Intronic
1102604463 12:114058016-114058038 CTGGAGACATACGTGGTTGTGGG - Intergenic
1103292668 12:119859920-119859942 CTGGAGAATGAGGTGGGTGAGGG - Intronic
1103492280 12:121331356-121331378 CTGGAGACACACGTGATCGTTGG + Exonic
1103549425 12:121726066-121726088 CTGGACAGAAAGGTGGTTAAAGG + Intronic
1104719735 12:131038652-131038674 CTGGAGGCAGAGGTGATGGAGGG + Intronic
1104866923 12:131961317-131961339 CTGGGGTCCCAGGTGGTGGATGG - Exonic
1104885472 12:132104685-132104707 CTGGGGTCCCAGGTGGTGGATGG - Exonic
1104942047 12:132399767-132399789 CTGGAGACTCAGGCGTTGGAGGG - Intergenic
1104968031 12:132518239-132518261 ATGGACAGACAGGTGGATGATGG - Intronic
1105510631 13:21049144-21049166 CTGGAGACATAGGAGGTCAAAGG + Intronic
1105730942 13:23214703-23214725 ATGGAGATGCAGGTGGTTTAAGG - Intronic
1106415269 13:29541048-29541070 CTGCAGCCACAGGTGGGAGAAGG + Intronic
1107215790 13:37916956-37916978 CTGGAGCAACAAGTAGTTGAAGG + Intergenic
1110884847 13:80619819-80619841 AAGGACACACAGGTGGATGAAGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113703364 13:112406174-112406196 CTGGAGACACATGGTGGTGATGG - Intronic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1117861053 14:60092835-60092857 CTGGAGAGACAAGAGGTTGTGGG - Intronic
1117899382 14:60516156-60516178 CTGGAGACAAAGGGGTGTGAGGG + Intergenic
1118302658 14:64629033-64629055 CTGGAGACAGGGGTGGGGGAGGG + Intergenic
1119193983 14:72703261-72703283 ATGGAGACACAGGGGATTGGGGG + Intronic
1119557959 14:75567848-75567870 GTGGAGACTCTGGTGGGTGAGGG + Intergenic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119944340 14:78676038-78676060 CTGGAGGAACAGCTGGTTGGTGG - Intronic
1120863424 14:89275283-89275305 CAGCAGACACAGCTGGCTGAAGG + Intronic
1121338389 14:93090877-93090899 CTGGAGGCGCAGGTTGGTGATGG - Intronic
1122059732 14:99128993-99129015 CTGGAGGCTCAGGTGGGTGAAGG + Intergenic
1122232909 14:100315985-100316007 CTGGGGCCACAGGTGGGCGAGGG + Intergenic
1122807732 14:104269055-104269077 CTGGAGTTACAGGTTTTTGAAGG + Intergenic
1122880170 14:104687269-104687291 CTGGAGGTACAGAGGGTTGAGGG + Intergenic
1125732242 15:41899617-41899639 CTGTGGACACAGGTGAATGAGGG - Exonic
1125834139 15:42735974-42735996 CTGGGGACACAGCTGATTGGGGG + Exonic
1126387360 15:48107787-48107809 CTTGACACACAGGTGTTGGAAGG + Intergenic
1127964982 15:63916565-63916587 CTGGGAAAACAGGTGGGTGAAGG - Intronic
1128126851 15:65199279-65199301 CGGGAAACAGAGTTGGTTGATGG + Intronic
1128177671 15:65570525-65570547 CTGAAGAAACAGGAGGTTGAAGG + Intronic
1128239428 15:66091547-66091569 CAGCAGACACAGTTAGTTGATGG - Intronic
1128241080 15:66101366-66101388 CTGGAGATGCAGGTTGTAGATGG - Intronic
1128270227 15:66302907-66302929 CTGGAGACAGATGTTGGTGATGG - Intronic
1128568738 15:68718274-68718296 CTGGAGACACAGGAGGCTTAGGG + Intronic
1129455731 15:75675416-75675438 CTGGAGACACCAGGGGTGGAGGG - Exonic
1129682660 15:77666558-77666580 CTGGAGGCAGAGGAGGGTGATGG + Intronic
1130101354 15:80896648-80896670 CTGGAATCACAGATTGTTGAAGG + Intronic
1130104676 15:80920427-80920449 CTGGAGCCGTAGGTGGTTAAGGG - Intronic
1130889059 15:88117924-88117946 CTGGAAGCACAGCTGGCTGAAGG + Intronic
1133026202 16:2989951-2989973 CTGGAGAGACAGGGAGGTGAGGG - Intergenic
1133176874 16:4022064-4022086 CTGGGCACAAAGGTGGCTGAGGG - Intronic
1133233162 16:4375889-4375911 CTGGCGTCACAGGTGGGAGACGG + Intronic
1134241880 16:12512630-12512652 ATGGATACGCAGGCGGTTGATGG + Intronic
1134838967 16:17385942-17385964 CTGAATACAGAGGTGGTTCAAGG + Intronic
1135498507 16:22973557-22973579 CTGGAGGCTAAGGTGGTAGAGGG - Intergenic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1139672579 16:68501829-68501851 ATGGAGACCAACGTGGTTGAAGG + Intergenic
1140202723 16:72907479-72907501 CTGGAGACAGGGGTGGTACAGGG - Intronic
1140783930 16:78321964-78321986 CTGCAGAGACAGGTTGTGGATGG + Intronic
1141390820 16:83661919-83661941 CTGTAGAGCCAGGAGGTTGAGGG + Intronic
1141495820 16:84408697-84408719 CTGGACACACAGGTGCTTCTGGG + Intronic
1141786892 16:86207008-86207030 CTGGTTACTCAGGAGGTTGAGGG + Intergenic
1142133941 16:88443148-88443170 CTGGAGACCCAGGATGTGGACGG + Intergenic
1142934417 17:3316076-3316098 CTGGGGGGACAGGTTGTTGATGG - Intergenic
1143288008 17:5805571-5805593 CTGGAGTCAGAGGAGGCTGAGGG - Intronic
1143453566 17:7051456-7051478 CTGGAGACAGATTTGGTAGAGGG - Intergenic
1144103966 17:11969577-11969599 CTAGAGGGACAGGTGGGTGAAGG + Exonic
1148105086 17:45114686-45114708 CAGGAGGAACAGGTTGTTGAAGG - Intronic
1149090332 17:52770371-52770393 GTGGAGAGACATGTGGTTAAAGG - Intergenic
1151745816 17:76011239-76011261 GTGGAGAGCCAGGTGGCTGAGGG + Intronic
1152751302 17:82063649-82063671 CTGGAGACACTGCTGGTTCTGGG - Intronic
1155298312 18:24405875-24405897 CTAGAGGGACAGGTAGTTGAAGG + Intergenic
1155546357 18:26919882-26919904 CTGGAGAGACAAGTAGTTCAAGG - Intronic
1157468578 18:47969609-47969631 CAGGAGACACTGATGGTTGCAGG - Intergenic
1158496650 18:57961014-57961036 CTGGAGACACATGGTGGTGATGG + Intergenic
1158827781 18:61242870-61242892 CTGGGGACAGAGGTGTTTCATGG - Intergenic
1160498306 18:79388056-79388078 CTGAGGACACAGGTGGGTGGGGG + Intergenic
1160970308 19:1764965-1764987 CTGAAGCCAGAGGTGGCTGAGGG + Intronic
1161316595 19:3620273-3620295 CTGCAGGCACAGGAGGCTGAGGG + Intronic
1161687817 19:5712071-5712093 CTGGTGGCACAGGTGGTCCAAGG + Intronic
1162621842 19:11849626-11849648 TAGGAGGCACAGGTGGTTGAGGG + Intronic
1162626539 19:11889023-11889045 TAGAAGGCACAGGTGGTTGAGGG + Intronic
1162630911 19:11925999-11926021 TAGAAGGCACAGGTGGTTGAGGG + Intronic
1162635774 19:11965928-11965950 TAGAAGGCACAGGTGGTTGAGGG + Intronic
1162638753 19:11990520-11990542 TAGAAGGCACAGGTGGTTGAGGG + Intergenic
1162659052 19:12155477-12155499 TAGAAGGCACAGGTGGTTGAGGG - Intronic
1163686637 19:18715619-18715641 CCGGGGCCACAGGTGGCTGAGGG - Intronic
1164636567 19:29795808-29795830 CTGCAGACAAAGGCGGATGAGGG + Intergenic
1165375255 19:35437360-35437382 CTGGATACACAGGAAGTAGAGGG - Intergenic
1166027177 19:40097577-40097599 CAGAAGACACCAGTGGTTGATGG + Intergenic
1166777271 19:45320706-45320728 CTGGCCACACAGCTGGTTGTAGG - Intronic
1167119862 19:47510370-47510392 CTGGAGAAATAGGTGGCAGAGGG - Intronic
1167621776 19:50564790-50564812 CAGGTGAGACAGGTGATTGAGGG + Intronic
1167765273 19:51478559-51478581 CAGGAGACACAGGTCTTGGAGGG + Intergenic
1168393267 19:56027975-56027997 CTGGAGACTGAGGTGGAAGAAGG - Exonic
1168452340 19:56476312-56476334 CTGACGACGCAGGTGGTTGGCGG + Intronic
926938264 2:18108007-18108029 CTGGAGGCATAGGTTTTTGAGGG + Intronic
928188910 2:29143357-29143379 GTGGAGACAGAGATGGTTGTAGG - Intronic
928303427 2:30146979-30147001 CTGGAGACTCGGGTGGCCGAGGG + Exonic
929029321 2:37636045-37636067 CTGAAGGCACAAGTGGGTGAAGG - Intergenic
929683844 2:44017579-44017601 CTGTAGACCCAGCTAGTTGAGGG + Intergenic
930714123 2:54576778-54576800 CTGGAAACACAGGTGTGTAAGGG + Intronic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
932820509 2:74895689-74895711 TGGGAGAAACAGGGGGTTGAGGG - Intergenic
933372953 2:81440513-81440535 CTGGGGGCACAGGTGGTGAATGG - Intergenic
934476879 2:94599549-94599571 GTGGATACACGGGTGGTTAATGG - Intronic
937277302 2:120693177-120693199 CTGGAGAAATAGGTGGTTCCAGG + Intergenic
937468391 2:122154758-122154780 CTGGACACTCAGGTGGTTTGGGG + Intergenic
938081989 2:128374957-128374979 GTGGAGGCACAGGTGGTGCAGGG + Intergenic
940385640 2:153068174-153068196 CTTGAGCCACAGGTGGTAGTTGG + Intergenic
946156320 2:217809104-217809126 ATGGAGATACAGATGGATGAAGG + Intronic
947918176 2:233848206-233848228 CAGGAGAGACAGGTGTTTAAAGG + Intronic
948614457 2:239189767-239189789 CTGGAGTCACCGGGAGTTGAGGG + Intronic
948897720 2:240935040-240935062 CTGGAGAGCCAGGTGGTTCAGGG - Intronic
948906643 2:240982830-240982852 CTGGAGACACTGGGGGTGGGAGG - Intronic
1172154700 20:32815994-32816016 CTGGAGACACAGGAAGTTACAGG - Intergenic
1172158085 20:32843717-32843739 ATATAGACACATGTGGTTGATGG + Intronic
1172435669 20:34927339-34927361 CTGGAGACAAAGCTGGTTTCCGG - Exonic
1172525767 20:35599997-35600019 GTTGAGGCAGAGGTGGTTGAGGG - Intergenic
1172651028 20:36501544-36501566 CTAGATTCACAGGTGGTTGGAGG + Intronic
1173705954 20:45110473-45110495 CTTGTGACACAGGTGGTTCATGG + Exonic
1174153100 20:48499987-48500009 CTGGAGACCCAGGGGGTAGCCGG - Intergenic
1175166678 20:57048953-57048975 ATGAAGACAGAGCTGGTTGAAGG + Intergenic
1175340839 20:58228237-58228259 CTGGAGCCGCTGGAGGTTGAAGG + Exonic
1175589551 20:60177718-60177740 CTGGGGTGACAGGTGGTAGAGGG + Intergenic
1176203751 20:63876979-63877001 CTGGGGACCCGGGTGGTTCATGG + Intronic
1177728867 21:25002571-25002593 CAGGAGACTCAGGTTATTGAAGG + Intergenic
1178810243 21:35875084-35875106 ATGGAGACACAGGTGTTTCCAGG + Intronic
1179268977 21:39833893-39833915 CTGGAGACGGAGGTTGGTGATGG - Intergenic
1179935332 21:44600335-44600357 CTGGAGCCAAAGGTAGGTGAGGG + Intronic
1181025758 22:20126513-20126535 CTGGGGACACAGGTGCTTCCTGG + Intronic
1181364812 22:22367730-22367752 CTGGAGACAGAAGTGGATGGAGG + Intergenic
1183016040 22:34988120-34988142 CTGGAGAGACAAGTGTTTCAAGG + Intergenic
1183411985 22:37660264-37660286 GTGGGGACACAGGAGGTGGAGGG - Intronic
1184642071 22:45878056-45878078 CTTGGGTCACAGGTGGGTGAGGG - Intergenic
1185094868 22:48800701-48800723 CAGCAGACACAGGTGGCTGGAGG + Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
954874211 3:53790642-53790664 TTGGCGATGCAGGTGGTTGAGGG + Intronic
956973893 3:74558010-74558032 CTAGAAATACAGGTGGCTGATGG + Intergenic
957086661 3:75685952-75685974 ATGGAGACACAGCAGGGTGAGGG - Intergenic
958144095 3:89601676-89601698 ATTGAGACAGAGGTGGTTGGAGG + Intergenic
960430920 3:117567607-117567629 CTGCAGACACTGGTGATTAATGG - Intergenic
961235072 3:125359185-125359207 CTGGAGACTCAGAGTGTTGAAGG - Intronic
961732507 3:128976619-128976641 CTGGAGACTCAGGAGTCTGAAGG + Intronic
963609752 3:147452412-147452434 CTGGAGACACAGGTGGTTGAGGG + Intronic
964541063 3:157780559-157780581 TTGGAGGCACAGGTGGTTTTTGG - Intergenic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
967766866 3:193290604-193290626 CTGGATACACAGGTGAATGGGGG + Intronic
967976946 3:195040829-195040851 CGGGTGACACAGGTGTTGGAGGG - Intergenic
968589882 4:1452050-1452072 CTGGAGCCCAAGGAGGTTGAGGG + Intergenic
968867549 4:3223343-3223365 CTGCAGGCAGAGGTGGTTGTGGG + Intronic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972727159 4:41754938-41754960 ATTGAAACACAGGAGGTTGAGGG - Intergenic
973173037 4:47168904-47168926 GTGGAGACACAGGGGGAAGATGG - Intronic
975745249 4:77468922-77468944 CTGAAGCCACAGGTGGCTGAGGG - Intergenic
976407695 4:84678470-84678492 CTGGAGAAACATCTCGTTGAAGG + Intronic
977219824 4:94325718-94325740 CAGGAAGCACAGGGGGTTGAGGG - Intronic
977665827 4:99646414-99646436 ATGGAAACACAGATGGTTAATGG + Intronic
980106674 4:128594781-128594803 CTGAAGACAAAAGTGGTTGGTGG - Intergenic
980169868 4:129276110-129276132 GTGAGGACACAGGTGGGTGATGG - Intergenic
980693097 4:136320953-136320975 GTGGATACACAGGTGCTTGAAGG + Intergenic
980771511 4:137379330-137379352 GTGAAGACACAGGAGGTTGACGG + Intergenic
984536243 4:180979402-180979424 CTGTAGTCCCAGGTGCTTGAGGG - Intergenic
984631912 4:182070135-182070157 GTGGAGGCACAGGTGGGGGAAGG + Intergenic
985112584 4:186561199-186561221 CTGGGTACTCAGGAGGTTGAGGG + Intergenic
985505654 5:278820-278842 CTGGGGACACAGGAGGGTGCTGG + Intronic
985803450 5:2021423-2021445 CTGGAGAAGCAGGTGGCGGAGGG - Intergenic
986351702 5:6886182-6886204 ATGGAGACTCAGGGGGTTGGGGG - Intergenic
986455104 5:7910791-7910813 CTGGAGAAACACCAGGTTGATGG + Intergenic
990603810 5:57387091-57387113 CTGAAGACACATGTGGCTGGTGG + Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
995310023 5:110699845-110699867 CTGGAGATATAGGTTATTGAAGG - Intronic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
995426162 5:112025859-112025881 ATGGAGAAACAGGTGGTTGGTGG - Intergenic
996485546 5:124029589-124029611 CTGCAGAATCAGGTGGGTGAAGG - Intergenic
998400365 5:141845688-141845710 GTGGAGACAAAGCTGGGTGAAGG - Intergenic
998651272 5:144124262-144124284 CTGGTACCACAGGTGGTTGCTGG + Intergenic
999187518 5:149723364-149723386 CTGGAGACTGGGGGGGTTGAGGG - Intergenic
1001270838 5:170310520-170310542 GTGAAGACACAGCTGGTTCAAGG - Intergenic
1001489662 5:172146479-172146501 GTGGAGACAAAGGAGGTAGAGGG - Intronic
1002093083 5:176816248-176816270 CTGGAGAGCCAGGTGGCTGCTGG + Intronic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1004139839 6:13007799-13007821 GTGGAGAAAGAGGTGATTGAAGG - Intronic
1004177994 6:13357250-13357272 CTTGAGCCACAGGAGGTAGAGGG + Intergenic
1004274334 6:14222350-14222372 CAGGAGAGACAGGGGGGTGACGG - Intergenic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1005461707 6:26075400-26075422 TTGGAGACAGAGGTGATTAACGG + Intergenic
1008296523 6:49785042-49785064 CTGTAGACAGAGGTAGTTTAGGG - Intergenic
1009653945 6:66515098-66515120 CTGGTGACACAGGAGGTTACAGG - Intergenic
1010897212 6:81379077-81379099 CAGAAGACACAAGTTGTTGAGGG - Intergenic
1011403403 6:86989425-86989447 TTGCAGACATAGGTGGTTGTTGG + Intronic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1012827075 6:104160037-104160059 CTAGAAACACAGGTGGCAGAGGG + Intergenic
1013548492 6:111183801-111183823 CTGAAGACACAGTTACTTGAGGG - Intronic
1016409339 6:143765571-143765593 CTGGAGCCACAGGGGGTGGAGGG - Exonic
1018635819 6:165858454-165858476 TTGAAGTCACAGTTGGTTGAAGG - Intronic
1018940911 6:168308456-168308478 CTGAGGACACAGCTGTTTGAGGG + Exonic
1019920551 7:4160763-4160785 CTGGAACCACAGGAGGTTAAGGG + Intronic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1022335217 7:29415572-29415594 CTCGGGACACAGTTGGTGGAGGG + Intronic
1023771246 7:43558529-43558551 CTGGAGACATTTTTGGTTGAGGG + Intronic
1024530163 7:50384633-50384655 CTGGAGACAAAGGTGGTACCTGG + Intronic
1024717627 7:52098834-52098856 CTAGAAACACAGGTTGGTGAGGG - Intergenic
1025270312 7:57505798-57505820 CCAGAAAGACAGGTGGTTGACGG + Intergenic
1025943996 7:66092624-66092646 CTGCAGTGACAGCTGGTTGAGGG - Exonic
1026255478 7:68707596-68707618 CTGGACAGGCAGGTGGTGGAGGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1027288808 7:76678986-76679008 CTGGAGCCACAGGTGAGTGGAGG - Intergenic
1028260558 7:88658994-88659016 CTGGAGGCAGAAGTGGTGGAAGG + Intergenic
1028968269 7:96827409-96827431 CTTGAGAAACAGTTGGGTGAGGG - Intergenic
1029374688 7:100170586-100170608 AGGGAGACACAGGTGGATGCCGG + Intronic
1033303779 7:140209436-140209458 CTGGAGACATGGGTGGCTGATGG - Intergenic
1034265273 7:149777683-149777705 CAGGAGGCACAGGTGGCCGAGGG - Intergenic
1034270112 7:149799665-149799687 CTGGAGAGAAAGGAGGGTGAGGG - Intergenic
1036059615 8:5301375-5301397 TTGGAGAAAGAGGTGGTGGAGGG + Intergenic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1039032538 8:33325915-33325937 CTGGAAACACAGGTGGGCGCGGG - Intergenic
1040103112 8:43522293-43522315 CTGGAAACAGTGTTGGTTGAGGG + Intergenic
1040857552 8:51963966-51963988 CTGGAGAAAAAGGAGGCTGAGGG - Intergenic
1042921520 8:73924651-73924673 CTGGAGATACAGGGTGGTGATGG + Intergenic
1043196304 8:77296478-77296500 TTGGAGACACAGCTGAATGATGG + Intergenic
1043577003 8:81669417-81669439 ATGGAGACACTGGGGGTTGAGGG - Intronic
1045947192 8:107809668-107809690 ATGGAGACATAAGTGGGTGAAGG + Intergenic
1046798139 8:118394734-118394756 CTTGAGACATAGTTGGATGATGG + Intronic
1047204297 8:122791049-122791071 CTGGAGCCACAGGTGCATGGAGG - Intronic
1047220831 8:122917008-122917030 CTGGGGACAGAGGTGCTGGAGGG - Intronic
1053537836 9:38943832-38943854 CTAGAGACACACGTTGTTGAGGG - Intergenic
1053931175 9:43114855-43114877 GTGGATACACGGGTGGTTAATGG + Intergenic
1054294273 9:63322046-63322068 GTGGATACACGGGTGGTTAACGG + Intergenic
1054392295 9:64626535-64626557 GTGGATACACGGGTGGTTAATGG + Intergenic
1054426943 9:65131746-65131768 GTGGATACACGGGTGGTTAATGG + Intergenic
1054503432 9:65889794-65889816 GTGGATACACGGGTGGTTAATGG - Intronic
1054628298 9:67420093-67420115 CTAGAGACACACGTTGTTGAGGG + Intergenic
1054741487 9:68810511-68810533 CTGTAGACACAAGAGGTTAAGGG - Intronic
1054764017 9:69027572-69027594 AAGGACACACAGGTAGTTGAGGG + Intergenic
1056898359 9:90573357-90573379 CTGGAGACAGAGGTTGTGAATGG - Intergenic
1056905707 9:90645858-90645880 CTGGATACCCAGCTGGGTGAGGG + Intergenic
1056999301 9:91492854-91492876 CTGGAGCCACAGGTGCTGGAGGG + Intergenic
1057917099 9:99065376-99065398 CTGGAGACTCTGGTGCCTGAGGG - Intronic
1057999741 9:99852837-99852859 CTGGAAAGACAGATGGTGGAGGG - Intronic
1059466664 9:114473075-114473097 CTGGAGACACATGAGCTTGGCGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061380117 9:130251098-130251120 AACGAGATACAGGTGGTTGATGG + Intergenic
1062528603 9:136989410-136989432 CTGGGGACACGCGTGGTGGATGG + Intergenic
1062727037 9:138080255-138080277 CTGGGGACAGAGGAGGGTGAGGG + Intronic
1203489574 Un_GL000224v1:90656-90678 CTGCAGATGCAGGTGGGTGAGGG - Intergenic
1203502196 Un_KI270741v1:32544-32566 CTGCAGATGCAGGTGGGTGAGGG - Intergenic
1187490178 X:19744112-19744134 CTGGAGACAAAGCTCGATGATGG + Intronic
1189223789 X:39395822-39395844 CTGCAGACACTGGCTGTTGAGGG + Intergenic
1189361833 X:40359152-40359174 GTGGAGGCCGAGGTGGTTGAAGG - Intergenic
1189659041 X:43278088-43278110 GTGGAGGCCGAGGTGGTTGAGGG - Intergenic
1190263548 X:48814652-48814674 CTGCAGACACAGGAGTGTGATGG - Intronic
1190733542 X:53240272-53240294 CTGGAGACATTTTTGGTTGAAGG + Intronic
1190915878 X:54810873-54810895 CTGGAACCACAGGTGGCCGAAGG + Exonic
1192085339 X:68090756-68090778 CTGCAGACATGGATGGTTGAAGG - Intronic
1192360576 X:70436289-70436311 CTGGAGACTCGGGTCGATGAAGG - Intergenic
1192587097 X:72327817-72327839 CTGGAGACAGAGGGGGCTGGTGG + Intergenic
1193640941 X:84009007-84009029 CTGGAGGCACAGGGGGTAGGGGG + Intergenic
1197889549 X:131255590-131255612 CAGGAGAAACAGGTGGTATATGG - Intergenic
1201066423 Y:10099957-10099979 ATGGAGACTCAGGAGGGTGAGGG - Intergenic